PRRX1 (NM_006902) Human Untagged Clone

CAT#: SC303848

PRRX1 (untagged)-Human paired related homeobox 1 (PRRX1), transcript variant pmx-1a

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRRX1
• Synonyms: AGOTC; PHOX1; PMX1; PRX-1; PRX1
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_006902 edited
  ATGACCTCCAGCTACGGGCACGTTCTGGAGCGGCAACCGGCGCTGGGCGGCCGCTTGGAC
  AGCCCGGGCAACCTCGACACCCTGCAGGCGAAAAAGAACTTCTCCGTCAGTCACCTGCTA
  GACCTGGAGGAAGCCGGGGACATGGTGGCGGCACAGGCGGATGAGAACGTGGGCGAGGCT
  GGCCGGAGCCTGCTGGAGTCGCCGGGACTCACCAGCGGCAGCGACACCCCGCAGCAGGAC
  AATGACCAGCTGAACTCAGAAGAAAAAAAGAAGAGAAAGCAGCGAAGGAATAGGACAACC
  TTCAATAGCAGCCAGCTGCAGGCTTTGGAGCGTGTCTTTGAGCGGACACACTATCCTGAT
  GCTTTTGTGCGAGAAGACCTTGCCCGCCGGGTGAACCTCACCGAGGCGAGAGTGCAGGTG
  TGGTTTCAGAACCGAAGAGCCAAGTTCCGCAGGAATGAGAGAGCCATGCTAGCCAATAAA
  AACGCTTCCCTCCTCAAATCCTACTCAGGAGACGTGACTGCTGTGGAGCAGCCCATCGTA
  CCTCGTCCTGCTCCGAGACCCACCGATTATCTCTCCTGGGGGACAGCGTCTCCGTACAGA
  TCCTCGTCCCTCCCAAGATGTTGTTTACACGAGGGGCTTCATAACGGATTCTAA
  
• Restriction Sites: Please inquire
• ACCN: NM_006902
• Insert Size: 700 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• OTI Annotation: This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_006902.3, NP_008833.1
• RefSeq Size: 4071 bp
• RefSeq ORF: 654 bp
• Locus ID: 5396
• UniProt ID: P54821
• Cytogenetics: 1q24.2
• Protein Families: Transcription Factors
• Gene Summary: The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins localized to the nucleus. The protein functions as a transcription co-activator, enhancing the DNA-binding activity of serum response factor, a protein required for the induction of genes by growth and differentiation factors. The protein regulates muscle creatine kinase, indicating a role in the establishment of diverse mesodermal muscle types. Alternative splicing yields two isoforms that differ in abundance and expression patterns. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (pmx-1a) includes an alternate exon in the 3' coding region, compared to variant pmx-1b. The resulting protein (pmx-1a) has a distinct C-terminus, compared to isoform pmx-1b.