FGF19 (NM_005117) Human Untagged Clone

CAT#: SC303586

Reviews ()
Write a review

FGF19 (untagged)-Human fibroblast growth factor 19 (FGF19)



  "NM_005117" in other vectors (6)

USD 462.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol FGF19
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_005117 edited
GCGCTGCGTCCAGGATCTAGGGCCACGACCATCCCAACCCGGCACTCACAGCCCCGCAGC
GCATCCCGGTCGCCGCCCAGCCTCCCGCACCCCCATCGCCGGAGCTGCGCCGAGAGCCCC
AGGGAGGTGCCATGCGGAGCGGGTGTGTGGTGGTCCACGTATGGATCCTGGCCGGCCTCT
GGCTGGCCGTGGCCGGGCGCCCCCTCGCCTTCTCGGACGCGGGGCCCCACGTGCACTACG
GCTGGGGCGACCCCATCCGCCTGCGGCACCTGTACACCTCCGGCCCCCACGGGCTCTCCA
GCTGCTTCCTGCGCATCCGTGCCGACGGCGTCGTGGACTGCGCGCGGGGCCAGAGCGCGC
ACAGTTTGCTGGAGATCAAGGCAGTCGCTCTGCGGACCGTGGCCATCAAGGGCGTGCACA
GCGTGCGGTACCTCTGCATGGGCGCCGACGGCAAGATGCAGGGGCTGCTTCAGTACTCGG
AGGAAGACTGTGCTTTCGAGGAGGAGATCCGCCCAGATGGCTACAATGTGTACCGATCCG
AGAAGCACCGCCTCCCGGTCTCCCTGAGCAGTGCCAAACAGCGGCAGCTGTACAAGAACA
GAGGCTTTCTTCCACTCTCTCATTTCCTGCCCATGCTGCCCATGGTCCCAGAGGAGCCTG
AGGACCTCAGGGGCCACTTGGAATCTGACATGTTCTCTTCGCCCCTGGAGACCGACAGCA
TGGACCCATTTGGGCTTGTCACCGGACTGGAGGCCGTGAGGAGTCCCAGCTTTGAGAAGT
AACTGAGACCATGCCCGGGCCTCTTCACTGCTGCCAGGGGCTGTGGTACCTGCAGCGTGG
GGGACGTGCTTCTACAAGAACAGTCCTGAGTCCACGTTCTGTTTAGCTTTAGGAAGAAAC
ATCTAGAAGTTGTACATATTCAGAGTTTTCCATTGGCAGTGCCAGTTTCTAGCCAATAGA
CTTGTCTGATCATAACATTGTAAGCCTGTAGCTTGCCCAGCTGCTGCCTGGGCCCCCATT
CTGCTCCCTCGAGGTTGCTGGACAAGCTGCTGCACTGTCTCAGTTCTGCTTGAATACCTC
CATCGATGGGGAACTCACTTCCTTTGGAAAAATTCTTATGTCAAGCTGAAATTCTCTAAT
TTTTTCTCATCACTTCCCCAGGAGCAGCCAGAAGACAGGCAGTAGTTTTAATTTCAGGAA
CAGGTGATCCACTCTGTAAAACAGCAGGTAAATTTCACTCAACCCCATGTGGGAATTGAT
CTATATCTCTACTTCCAGGGACCATTTGCCCTTCCCAAATCCCTCCAGGCCAGAACTGAC
TGGAGCAGGCATGGCCCACCAGGCTTCAGGAGTAGGGGAAGCCTGGAGCCCCACTCCAGC
CCTGGGACAACTTGAGAATTCCCCCTGAGGCCAGTTCTGTCATGGATGCTGTCCTGAGAA
TAACTTGCTGTCCCGGTGTCACCTGCTTCCATCCCCCAGCCCACCAGCCCTCTGCCCACC
TCACATGCCTCCCCATGGATTGGGGCCTCCCAGGCCCCCCACCTTATGTCAACCTGCACT
TCTTGTTCAAAAATCAGGAAAAGAAAAGATTTGAAGACCCCAAGTCTTGTCAATAACTTG
CTGTGTGGAAGCAGCGGGGGAAGACCTAGAACCCTTTCCCCAGCACTTGGTTTTCCAACA
TGATATTTATGAGTAATTTATTTTGATATGTACATCTCTTATTTTCTTACATTATTTATG
CCCCCAAATTATATTTATGTATGTAAGTGAGGTTTGTTTTGTATATTAAAATGGAGTTTG
TTTGTATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_005117
Insert Size 1900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005117.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005117.2, NP_005108.1
RefSeq Size 2157 bp
RefSeq ORF 651 bp
Locus ID 9965
UniProt ID O95750
Cytogenetics 11q13.3
Protein Families Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Secreted Protein, Transmembrane
Protein Pathways MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton
Gene Summary The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. This growth factor is a high affinity, heparin dependent ligand for FGFR4. Expression of this gene was detected only in fetal but not adult brain tissue. Synergistic interaction of the chick homolog and Wnt-8c has been shown to be required for initiation of inner ear development. [provided by RefSeq, Jul 2008]

Other Versions

Other products for "FGF19"
Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 473.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00


FGF19 rabbit polyclonal antibody
    • 100 ul

USD 380.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 55.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.