APOBEC3B (NM_004900) Human Untagged Clone

SKU
SC303543
APOBEC3B (untagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B (APOBEC3B)
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol APOBEC3B
Synonyms A3B; APOBEC1L; ARCD3; ARP4; bK150C2.2; DJ742C19.2; PHRBNL
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_004900 edited
CAAAAAAAGAGCGGGACAGGGACAAGCGTATCTAAGAGGCTGAACATGAATCCACAGATC
AGAAATCCGATGGAGCGGATGTATCGAGACACATTCTACGACAACTTTGAAAACGAACCC
ATCCTCTATGGTCGGAGCTACACTTGGCTGTGCTATGAAGTGAAAATAAAGAGGGGCCGC
TCAAATCTCCTTTGGGACACAGGGGTCTTTCGAGGCCAGGTGTATTTCAAGCCTCAGTAC
CACGCAGAAATGTGCTTCCTCTCTTGGTTCTGTGGCAACCAGCTGCCTGCTTACAAGTGT
TTCCAGATCACCTGGTTTGTATCCTGGACCCCCTGCCCGGACTGTGTGGCGAAGCTGGCC
GAATTCCTGTCTGAGCACCCCAATGTCACCCTGACCATCTCTGCCGCCCGCCTCTACTAC
TACTGGGAAAGAGATTACCGAAGGGCGCTCTGCAGGCTGAGTCAGGCAGGAGCCCGCGTG
ACGATCATGGACTATGAAGAATTTGCATACTGCTGGGAAAACTTTGTGTACAATGAAGGT
CAGCAATTCATGCCTTGGTACAAATTCGATGAAAATTATGCATTCCTGCACCGCACGCTA
AAGGAGATTCTCAGATACCTGATGGATCCAGACACATTCACTTTCAACTTTAATAATGAC
CCTTTGGTCCTTCGACGGCGCCAGACCTACTTGTGCTATGAGGTGGAGCGCCTGGACAAT
GGCACCTGGGTCCTGATGGACCAGCACATGGGCTTTCTATGCAACGAGGCTAAGAATCTT
CTCTGTGGCTTTTACGGCCGCCATGCGGAGCTGCGCTTCTTGGACCTGGTTCCTTCTTTG
CAGTTGGACCCGGCCCAGATCTACAGGGTCACTTGGTTCATCTCCTGGAGCCCCTGCTTC
TCCTGGGGCTGTGCCGGGGAAGTGCGTGCGTTCCTTCAGGAGAACACACACGTGAGACTG
CGCATCTTCGCTGCCCGCATCTATGATTACGACCCCCTATATAAGGAGGCGCTGCAAATG
CTGCGGGATGCTGGGGCCCAAGTCTCCATCATGACCTACGATGAGTTTGAGTACTGCTGG
GACACCTTTGTGTACCGCCAGGGATGTCCCTTCCAGCCCTGGGATGGACTAGAGGAGCAC
AGCCAAGCCCTGAGTGGGAGGCTGCGGGCCATTCTCCAGGTGAGGGCTTCCTCCCTCTGC
CTGGTGCCCCATCGGCCTCCCCCTCCTCCCCGCTCCCCTGTGCCTTGCCTTCCCCTCTGC
TCAGAGCCTCCTCTGGGTTCCCTGCTCCCCACAGGGCGCCCAGCTCCGTCCCTCCCTTTC
CTTCTCACAGCCTCCTTCTCTTTCCCACCTCCCGCATCCCTCCCTCCTCTCCCGTCATTG
TCACTGTCCCCAGGCCACCTCCCTGTGCCCTCTTTCCACTCTCTCACCTCCTGCTCCATT
CAACCCCCCTGCTCTTCCAGAATCAGGGAAACTGAAGGATGGGCCTCAGTCTCTAAGGAA
GGCAGAGACCTGGGTTGAGCAGCAGAATAAAAGATCTTCTTCCAAGAAATGCAAACAGAC
CGTTCACCACCATCTCCAGCTGCTCACAGACACCAGCAAAGCAATGTGCTCCTGATCAAG
TAGATTTTTTAAAAATCAGAGTCAATTAATTTTAATTGAAAATTTCTCTTATGTTCCAAG
TGTACAAGAGTAAGATTATGCTCAATATTCCCAGAATAGTTTTCAATGTATTAATGAAGT
GATTAATTGGCTCCATATTTAGACTAATAAAACATTAAGAATCTTCCATAA
Restriction Sites Please inquire
ACCN NM_004900
Insert Size 1400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be 108 amino acids longer than NM_004900.3 at the 3'.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004900.3, NP_004891.3
RefSeq Size 1536 bp
RefSeq ORF 1149 bp
Locus ID 9582
UniProt ID Q9UH17
Cytogenetics 22q13.1
Summary This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. A hybrid gene results from the deletion of approximately 29.5 kb of sequence between this gene, APOBEC3B, and the adjacent gene APOBEC3A. The breakpoints of the deletion are within the two genes, so the deletion allele is predicted to have the promoter and coding region of APOBEC3A, but the 3' UTR of APOBEC3B. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a).
Write Your Own Review
You're reviewing:APOBEC3B (NM_004900) Human Untagged Clone
Your Rating
SKU Description Size Price
RC222712 APOBEC3B (Myc-DDK-tagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B (APOBEC3B) 10 ug
$289.00 MSRP $457.00 MSRP $457.00
RC222712L1 Lenti-ORF clone of APOBEC3B (Myc-DDK-tagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B (APOBEC3B) 10 ug
$757.00
RC222712L2 Lenti-ORF clone of APOBEC3B (mGFP-tagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B (APOBEC3B) 10 ug
$757.00
RC222712L3 Lenti-ORF clone of APOBEC3B (Myc-DDK-tagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B (APOBEC3B) 10 ug
$757.00
RC222712L4 Lenti-ORF clone of APOBEC3B (mGFP-tagged)-Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B (APOBEC3B) 10 ug
$757.00
RG222712 APOBEC3B (tGFP-tagged) - Human apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3B (APOBEC3B) 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.