POU4F2 (NM_004575) Human Untagged Clone

SKU
SC303502
POU4F2 (untagged)-Human POU class 4 homeobox 2 (POU4F2)
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol POU4F2
Synonyms Brn-3b; BRN3.2; BRN3B
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_004575, the custom clone sequence may differ by one or more nucleotides


ATGATGATGATGTCCCTGAACAGCAAGCAGGCGTTTAGCATGCCGCACGGCGGCAGCCTGCACGTGGAGC
CCAAGTACTCGGCACTGCACAGCACCTCGCCGGGCTCCTCGGCTCCCATCGCGCCCTCGGCCAGCTCCCC
CAGCAGCTCGAGCAACGCTGGTGGTGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCCGAAGC
AGCAGCTCCAGCAGCAGTGGCAGCAGCGGCGGCGGGGGCTCGGAGGCTATGCGGAGAGCCTGTCTTCCAA
CCCCACCGAGCAATATATTCGGCGGGCTGGATGAGAGTCTGCTGGCCCGCGCCGAGGCTCTGGCAGCCGT
GGACATCGTCTCCCAGAGCAAGAGCCACCACCACCATCCACCCCACCACAGCCCCTTCAAACCGGACGCC
ACCTACCACACTATGAATACCATCCCGTGCACGTCGGCCGCCTCTTCTTCATCGGTGCCCATCTCGCACC
CTTCCGCGTTGGCGGGCACGCACCACCACCACCACCATCACCACCACCACCACCACCAACCGCACCAGGC
GCTGGAGGGCGAGCTGCTGGAGCACCTGAGTCCCGGGCTGGCCCTGGGCGCTATGGCGGGCCCCGACGGC
GCTGTGGTGTCCACGCCGGCTCACGCGCCGCACATGGCCACCATGAACCCCATGCACCAAGCAGCGCTCA
GCATGGCCCACGCGCACGGGCTGCCGTCGCACATGGGCTGCATGAGCGACGTGGACGCCGACCCGCGGGA
CCTGGAGGCATTCGCCGAGCGCTTCAAGCAGCGACGCATCAAGCTGGGGGTGACCCAGGCAGATGTGGGC
TCCGCGCTGGCCAACCTCAAGATCCCCGGCGTGGGCTCGCTTAGCCAGAGCACCATCTGCAGGTTCGAGT
CCCTCACACTGTCCCACAATAATATGATCGCGCTCAAACCCATCCTGCAGGCATGGCTCGAGGAGGCCGA
GAAGTCCCACCGCGAGAAGCTCACCAAGCCTGAACTCTTCAATGGCGCGGAGAAGAAGCGCAAGCGCACG
TCCATCGCTGCGCCAGAGAAGCGCTCGCTCGAAGCCTACTTTGCCATTCAGCCTCGGCCCTCCTCTGAAA
AGATCGCCGCCATCGCGGAGAAGCTGGACCTGAAGAAAAACGTGGTGCGCGTCTGGTTCTGCAACCAGAG
GCAGAAACAGAAAAGAATGAAATATTCCGCCGGCATTTAG


Restriction Sites Please inquire
ACCN NM_004575
Insert Size 1200 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004575.1, NP_004566.1
RefSeq Size 3110 bp
RefSeq ORF 1233 bp
Locus ID 5458
UniProt ID Q12837
Cytogenetics 4q31.22
Protein Families Transcription Factors
Summary The protein encoded by this gene is a member of the POU-domain transcription factor family and may be involved in maintaining visual system neurons in the retina. The level of the encoded protein is also elevated in a majority of breast cancers, resulting in accelerated tumor growth. [provided by RefSeq, Sep 2011]
Write Your Own Review
You're reviewing:POU4F2 (NM_004575) Human Untagged Clone
Your Rating
SKU Description Size Price
RC215962 POU4F2 (Myc-DDK-tagged)-Human POU class 4 homeobox 2 (POU4F2) 10 ug
$686.00
RC215962L1 Lenti ORF clone of Human POU class 4 homeobox 2 (POU4F2), Myc-DDK-tagged 10 ug
$986.00
RC215962L2 Lenti ORF clone of Human POU class 4 homeobox 2 (POU4F2), mGFP tagged 10 ug
$986.00
RC215962L3 Lenti ORF clone of Human POU class 4 homeobox 2 (POU4F2), Myc-DDK-tagged 10 ug
$986.00
RC215962L4 Lenti ORF clone of Human POU class 4 homeobox 2 (POU4F2), mGFP tagged 10 ug
$986.00
RG215962 POU4F2 (tGFP-tagged) - Human POU class 4 homeobox 2 (POU4F2) 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.