CEBP Alpha(CEBPA) (NM_004364) Human Untagged Clone

CAT#: SC303472

CEBPA (untagged)-Human CCAAT/enhancer binding protein (C/EBP), alpha (CEBPA)

USD 577


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CEBP Alpha(CEBPA) (NM_004364) Human Untagged Clone
Symbol CEBPA
Synonyms C/EBP-alpha; CEBP
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC303472 sequence for NM_004364 edited (data generated by NextGen Sequencing)
ATGGAGTCGGCCGACTTCTACGAGGCGGAGCCGCGGCCCCCGATGAGCAGCCACCTGCAG
AGCCCCCCGCACGCGCCCAGCAGCGCCGCCTTCGGCTTTCCCCGGGGCGCGGGCCCCGCG
CAGCCTCCCGCCCCACCTGCCGCCCCGGAGCCGCTGGGCGGCATCTGCGAGCACGAGACG
TCCATCGACATCAGCGCCTACATCGACCCGGCCGCCTTCAACGACGAGTTCCTGGCCGAC
CTGTTCCAGCACAGCCGGCAGCAGGAGAAGGCCAAGGCGGCCGTGGGCCCCACGGGCGGC
GGCGGCGGCGGCGACTTTGACTACCCGGGCGCGCCCGCGGGCCCCGGCGGCGCCGTCATG
CCCGGGGGAGCGCACGGGCCCCCGCCCGGCTACGGCTGCGCGGCCGCCGGCTACCTGGAC
GGCAGGCTGGAGCCCCTGTACGAGCGCGTCGGGGCGCCGGCGCTGCGGCCGCTGGTGATC
AAGCAGGAGCCCCGCGAGGAGGATGAAGCCAAGCAGCTGGCGCTGGCCGGCCTCTTCCCT
TACCAGCCGCCGCCGCCGCCGCCGCCCTCGCACCCGCACCCGCACCCGCCGCCCGCGCAC
CTGGCCGCCCCGCACCTGCAGTTCCAGATCGCGCACTGCGGCCAGACCACCATGCACCTG
CAGCCCGGTCACCCCACGCCGCCGCCCACGCCCGTGCCCAGCCCGCACCCCGCGCCCGCG
CTCGGTGCCGCCGGCCTGCCGGGCCCTGGCAGCGCGCTCAAGGGGCTGGGCGCCGCGCAC
CCCGACCTCCGCGCGAGTGGCGGCAGCGGCGCGGGCAAGGCCAAGAAGTCGGTGGACAAG
AACAGCAACGAGTACCGGGTGCGGCGCGAGCGCAACAACATCGCGGTGCGCAAGAGCCGC
GACAAGGCCAAGCAGCGCAACGTGGAGACGCAGCAGAAGGTGCTGGAGCTGACCAGTGAC
AATGACCGCCTGCGCAAGCGGGTGGAACAGCTGAGCCGCGAACTGGACACGCTGCGGGGC
ATCTTCCGCCAGCTGCCAGAGAGCTCCTTGGTCAAGGCCATGGGCAACTGCGCGTGA

Clone variation with respect to NM_004364.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004364 unedited
CCCTTATGGAGTCGGCCGACTTCTACGAGGCGGAGCCGCGGCCCCCGATGAGCAGCCACC
TGCAGAGCCCCCCGCACGCGCCCAGCAGCGCCGCCTTCGGCTTTCCCCGGGGCGCGGGCC
CCGCGCAGCCTCCCGCCCCACCTGCCGCCCCGGAGCCGCTGGGCGGCATCTGCGAGCACG
AGACGTCCATCGACATCAGCGCCTACATCGACCCGGCCGCCTTCAACGACGAGTTCCTGG
CCGACCTGTTCCAGCACAGCCGGCAGCAGGAGAAGGCCAAGGCGGCCGTGGCCCCACGGG
CGG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004364 unedited
GTTCAGGAAAAGCTATGACCGCGGCCGCAATCTAGAGTCGACAAGCTTGATATCGGTACC
AGATCTGAATTCGCCCTTGCACCGGAATCTCCTAGTCCTGGCTCGCACGGCTCGGGCAAG
CCTCGAGATCCGGCGACCCCAAACCACTCCCTGGGTCCCCGCCGGAGGCTGGCCCAGGGC
GGTCCCACAGCCGCGCGCCTCACGCGCAGTTGCCCATGGCCTTGACCAAGGAGCTCTCTG
GCAGCTGGCGGAAGATGCCCCGCAGCGTGTCCAGTTCGCGGCTCAGCTGTTCCACCCGCT
TGCGCAGGCGGTCATTGTCACTGGTCAGCTCCAGCACCTTCTGCTGCGTCTCCACGTTGC
GCTGCTTGGCCTTGTCGCGGCTCTTGCGCACCGCGATGTTGTTGCGCTCGCGCCGCACCC
GGTACTCGTTGCTGTTCTTGTCCACCGACTTCTTGGCCTTGCCCGCGCCGCTGCCGCCAC
TCGCGCGGAGGTCGGGGTGCGCGGCGCCCAGCCCCTTGAGCGCGCTGCCAGGGCCCGGCA
GGCCGGCGGCACCGAGCGCGGGCGCGGGGTGCGGGCTGGGCACGGGCGTGGGCGGCGGCG
TGGGGTGACCGGGCTGCAGGTGCATGGTGGTCTGGCCGCAGTGCGCGATCTGGAACTGCA
GGTGCGGGGCGGCCAGGTGCGCGGGCGGCGGGTGCGGGTGCGGTCCAAAAGGGCGGNNNN
NNNNNNNNNNNNNNNN
Tag Tag Free
ACCN NM_004364
ORF Size 1077 bp
Insert Size 1200
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004364.2, NP_004355
RefSeq Size 2385
RefSeq ORF 1077
Locus ID 1050
Cytogenetics 19q13.11
Protein Families ES Cell Differentiation/IPS, Druggable Genome
Protein Pathways Pathways in cancer, Acute myeloid leukemia
Gene Summary This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain and recognizes the CCAAT motif in the promoters of target genes. The encoded protein functions in homodimers and also heterodimers with CCAAT/enhancer-binding proteins beta and gamma. Activity of this protein can modulate the expression of genes involved in cell cycle regulation as well as in body weight homeostasis. Mutation of this gene is associated with acute myeloid leukemia. The use of alternative in-frame non-AUG (GUG) and AUG start codons results in protein isoforms with different lengths. Differential translation initiation is mediated by an out-of-frame, upstream open reading frame which is located between the GUG and the first AUG start codons. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (1) can initiate translation from an upstream non-AUG (GUG) site, and also from three downstream, in-frame AUG sites. The isoform (a, also known as C/EBP-42) represented in this RefSeq results from translation initiation at the first AUG start codon. Isoform a has a shorter N-terminus, compared to isoform c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations