GIP (NM_004123) Human Untagged Clone

SKU SC303436

GIP (untagged)-Human gastric inhibitory polypeptide (GIP)

Product Data

• Type: Human Untagged Clone
• Target Symbol: GIP
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_004123 edited; AGGCTCAGAAGGTCCAGAAATCAGGGGAAGGAGACCCCTATCTGTCCTTCTTCTGGAAGA; GCTGGAAAGGAAGTCTGCTCAGGAAATAACCTTGGAAGATGGTGGCCACGAAGACCTTTG; CTCTGCTGCTGCTGTCCCTGTTCCTGGCAGTGGGACTAGGAGAGAAGAAAGAGGGTCACT; TCAGCGCTCTCCCCTCCCTGCCTGTTGGATCTCATGCTAAGGTGAGCAGCCCTCAACCTC; GAGGCCCCAGGTACGCGGAAGGGACTTTCATCAGTGACTACAGTATTGCCATGGACAAGA; TTCACCAACAAGACTTTGTGAACTGGCTGCTGGCCCAAAAGGGGAAGAAGAATGACTGGA; AACACAACATCACCCAGAGGGAGGCTCGGGCGCTGGAGCTGGCCGGTCAAGCTAATAGGA; AGGAGGAGGAGGCAGTGGAGCCACAGAGCTCCCCAGCCAAGAACCCCAGCGATGAAGATT; TGCTGCGGGACTTGCTGATTCAAGAGCTGTTGGCCTGCTTGCTGGATCAGACAAACCTCT; GCAGGCTCAGGTCTCGGTGACTCTGACCACACCCAGCTCAGGACTGGATTCTGCCCTTCA; CTTAGCACCTGCCTCAGCCCCACTCCAGAATAGCCAAGAGAACCCAAACCAATAAAGTTT; ATGCTAAGTCGAGCCCATTGTGAAAATTTATTAAAATGACTACTGAGCACT;
• Restriction Sites: Please inquire
• ACCN: NM_004123
• Insert Size: 700 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_004123.2.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_004123.2, NP_004114.1
• RefSeq Size: 711 bp
• RefSeq ORF: 462 bp
• Locus ID: 2695
• UniProt ID: P09681
• Cytogenetics: 17q21.32
• Protein Families: Druggable Genome, Secreted Protein
• Summary: This gene encodes an incretin hormone and belongs to the glucagon superfamily. The encoded protein is important in maintaining glucose homeostasis as it is a potent stimulator of insulin secretion from pancreatic beta-cells following food ingestion and nutrient absorption. This gene stimulates insulin secretion via its G protein-coupled receptor activation of adenylyl cyclase and other signal transduction pathways. It is a relatively poor inhibitor of gastric acid secretion. [provided by RefSeq, Jul 2008]