Frizzled 7(FZD7) (NM_003507) Human Untagged Clone

CAT#: SC303322

FZD7 (untagged)-Human frizzled family receptor 7 (FZD7)

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Frizzled 7(FZD7) (NM_003507) Human Untagged Clone
Symbol FZD7
Synonyms FzE3
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003507 edited
ACTCGCGGCCGGCGATGCGGGACCCCGGCGCGGCCGCTCCGCTTTCGTCCCTGGGCCTCT
GTGCCCTGGTGCTGGCGCTGCTGGGCGCACTGTCCGCGGGCGCCGGGGCGCAGCCGTACC
ACGGAGAGAAGGGCATCTCCGTGCCGGACCACGGCTTCTGCCAGCCCATCTCCATCCCGC
TGTGCACGGACATCGCCTACAACCAGACCATCCTGCCCAACCTGCTGGGCCACACGAACC
AAGAGGACGCGGGCCTCGAGGTGCACCAGTTCTACCCGCTGGTGAAGGTGCAGTGTTCTC
CCGAACTCCGCTTTTTCTTATGCTCCATGTATGCGCCCGTGTGCACCGTGCTCGATCAGG
CCATCCCGCCGTGTCGTTCTCTGTGCGAGCGCGCCCGCCAGGGCTGCGAGGCGCTCATGA
ACAAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGCGAGAACTTCCCGGTGCACGGTG
CGGGCGAGATCTGCGTGGGCCAGAACACGTCGGACGGCTCCGGGGGCCCAGGCGGCGGCC
CCACTGCCTACCCTACCGCGCCCTACCTGCCGGACCTGCCCTTCACCGCGCTGCCCCCGG
GGGCCTCAGATGGCAGGGGGCGTCCCGCCTTCCCCTTCTCATGCCCCCGTCAGCTCAAGG
TGCCCCCGTACCTGGGCTACCGCTTCCTGGGTGAGCGCGATTGTGGCGCCCCGTGCGAAC
CGGGCCGTGCCAACGGCCTGATGTACTTTAAGGAGGAGGAGAGGCGCTTCGCCCGCCTCT
GGGTGGGCGTGTGGTCCGTGCTGTGCTGCGCCTCGACGCTCTTTACCGTTCTCACCTACC
TGGTGGACATGCGGCGCTTCAGCTACCCAGAGCGGCCCATCATCTTCCTGTCGGGCTGCT
ACTTCATGGTGGCCGTGGCGCACGTGGCCGGCTTCCTTCTAGAGGACCGCGCCGTGTGCG
TGGAGCGCTTCTCGGACGATGGCTACCGCACGGTGGCGCAGGGCACCAAGAAGGAGGGCT
GCACCATCCTCTTCATGGTGCTCTACTTCTTCGGCATGGCCAGCTCCATCTGGTGGGTCA
TTCTGTCTCTCACTTGGTTCCTGGCGGCCGGCATGAAGTGGGGCCACGAGGCCATCGAGG
CCAACTCGCAGTACTTCCACCTGGCCGCGTGGGCCGTGCCCGCCGTCAAGACCATCACTA
TCCTGGCCATGGGCCAGGTAGACGGGGACCTGCTGAGCGGGGTGTGCTACGTTGGCCTCT
CCAGTGTGGACGCGCTGCGGGGCTTCGTGCTGGCGCCTCTGTTCGTCTACCTCTTCATAG
GCACGTCCTTCTTGCTGGCCGGCTTCGTGTCCCTCTTCCGTATCCGCACCATCATGAAAC
ACGACGGCACCAAGACCGAGAAGCTGGAGAAGCTCATGGTGCGCATCGGCGTCTTCAGCG
TGCTCTACACAGTGCCCGCCACCATCGTCCTGGCCTGCTACTTCTACGAGCAGGCCTTCC
GCGAGCACTGGGAGCGCACCTGGCTCCTGCAGACGTGCAAGAGCTATGCCGTGCCCTGCC
CGCCCGGCCACTTCCCGCCCATGAGCCCCGACTTCACCGTCTTCATGATCAAGTACCTGA
TGACCATGATCGTCGGCATCACCACTGGCTTCTGGATCTGGTCGGGCAAGACCCTGCAGT
CGTGGCGCCGCTTCTACCACAGACTTAGCCACAGCAGCAAGGGGGAGACTGCGGTATGAG
CCCCGGCCCCTCCCCACCTTTCCCACCCCAGCCCTCTTGCAAGAGGAGAGGCACGGTAGG
GAAAAGAACTGCTGGGTGGGGGCCTGTTTCTGTAACTTTCTCCCCCTCTACTGAGAAGTG
ACCTGGAAGTGAGAAGTTTTTTGCAGATTTGGGGCGAGGGGTGATTTGGAAAAGAAGACC
TGTGTGGAAAGCGGTTTGGATGAAAAGATTTCAGGCAAAGACTTGCAGGAAGATGATGAT
AACGGCGATGTGAATCGTCAAAGGTACGGGCCAGCTTGTGCCTAATAGAAGGTTGAGACC
AGCAGAGACTGCTGTGAGTTTCTCCCGGCTCCGAGGCTGAACGGGGACTGTGAGCGATCC
CCCTGCTGCAGGGCGAGTGGCCTGTCCAGACCCCTGTGAGGCCCCGGGAAAGGTACAGCC
CTGTCTGCGGTGGCTGCTTTGTTGGAAAGAGGGAGGGCCTCCTGCGGTGTGCTTGTCAAG
CAGTGGTCAAACCATAATCTCTTTTCACTGGGGCCAAACTGGAGCCCAGATGGGTTAATT
TCCAGGGTCAGACATTACGGTCTCTCCTCCCCTGCCCCCTCCCGCCTGTTTTTCCTCCCG
TACTGCTTTCAGGTCTTGTAAAATAAGCATTTGGAAGTCTTGGGAGGCCTGCCTGCTAGA
ATCCTAATGTGAGGATGCAAAAGAAATGATGATAACATTTTGAGATAAGGCCAAGGAGAC
GTGGAGTAGGTATTTTTGCTACTTTTTCATTTTCTGGGGAAGGCAGGAGGCAGAAAGACG
GGTGTTTTATTTGGTCTAATACCCTGAAAAGAAGTGATGACTTGTTGCTTTTCAAAACAG
GAATGCATTTTTCCCCTTGTCTTTGTTGTAAGAGACAAAAGAGGAAACAAAAGTGTCTCC
CTGTGGAAAGGCATAACTGTGACGAAAGCAACTTTTATAGGCAAAGCAGCGCAAATCTGA
GGTTTCCCGTTGGTTGTTAATTTGGTTGAGATAAACATTCCTTTTTAAGGAAAAGTGAAG
AGCAGTGTGCTGTCACACACCGTTAAGCCAGAGGTTCTGACTTCGCTAAAGGAAATGTAA
GAGGTTTTGTTGTCTGTTTTAAATAAATTTAATTCGGAACACATGATCCAACAGACTATG
TTAAAATATTCAGGGAAATCTCTCCCTTCATTTACTTTTTCTTGCTATAAGCCTATATTT
AGGTTTCTTTTCTATTTTTTTCTCCCATTTGGATCCTTTGAGGTAAAAAAACATAATGTC
TTCAGCCTCATAATAAAGGAAAGTTAATTAAAAAAAAAAAGCAAAGAAAAAAAAAAAAAA
AAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for BC015915 unedited
AAAGAAGCTCGGGTTTTGTAACCGACTTACTTNGGGCGGCCGCGCATTCGGCACGAGGAC
TCGCGGCCGGCGATGCGGGACCCCGGCGCGGCCGCTCCGCTTTCGTCCCTGGGCCTCTGT
GCCCTGGTGCTGGCGCTGCTGGGCGCACTGTCCGCGGGCGCCGGGGCGCAGCCGTACCAC
GGAGAGAAGGGCATCTCCGTGCCGGACCACGGCTTCTGCCAGCCCATCTCCATCCCGCTG
TGCACGGACATCGCCTACAACCAGACCATCCTGCCCAACCTGCTGGGCCACACGAACCAA
GAGGACGCGGGCCTCGAGGTGCACCAGTTCTACCCGCTGGTGAAGGTGCAGTGTTCTCCC
GAACTCCGCTTTTTCTTATGCTCCATGTATGCGCCCGTGTGCACCGTGCTCGATCAGGCC
ATCCCGCCGTGTCGTTCTCTGTGCGAGCGCGCCCGCCAGGGCTGCGAGGCGCTCATGAAC
AAGTTCGGCTTCCAGTGGCCCGAGCGGCTGCGCTGCGAGAACTTCCCGGTGCACGGTGCG
GGCGAGATCTGCGTGGGCCAGAACACGTCGGACGGCTCCGGGGGCCCATGCGGCGGCCCC
ACTGCCTACCCTACCGCGCCCTACCTGCCGGACCTGCCCTTCACCGCGCTGCCCCCGGGG
GCCTCAGATGGCAGGGGGCGTCCCGCCTTCCCCTTCTCATGCCCCCGTCAGCTCAAGGTG
CCCCCGTACCTGGGCTACCGCTTCCTGGGTGAGCGCGATTGTGGCGCCCCGTGCGAACCG
GGCCGTGCCAACGGCCTGATGTACTTTAAGGAGGAGAGAGGCGCTTCGGCCGCCTCTGGG
TGGGGCGTGTGGTGCCGTGCTGTGCTGCGCCCTCGACGCTCTTTACCA
Tag Tag Free
ACCN NM_003507
ORF Size 1725 bp
Insert Size 3100
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid D
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003507.1, NP_003498
RefSeq Size 3851
Locus ID 8324
Cytogenetics 2q33.1
Protein Families Transmembrane, Druggable Genome
Protein Pathways Wnt signaling pathway, Melanogenesis, Pathways in cancer, Colorectal cancer, Basal cell carcinoma
Gene Summary Receptor for Wnt proteins. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, but it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. May be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations