SOX11 (NM_003108) Human Untagged Clone

CAT#: SC303275

SOX11 (untagged)-Human SRY (sex determining region Y)-box 11 (SOX11)

USD 701.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name SOX11 (NM_003108) Human Untagged Clone
Symbol SOX11
Synonyms MRD27; MRD27
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_003108 edited
AGCCCTGCAGCGGATCATGGTGCAGCAGGCGGAGAGCTTGGAAGCGGAGAGCAACCTGCC
CCGGGAGGCGCTGGACACGGAGGAGGGCGAATTCATGGCTTGCAGCCCGGTGGCCCTGGA
CGAGAGCGACCCAGACTGGTGCAAGACGGCGTCGGGCCACATCAAGCGGCCGATGAACGC
GTTCATGGTATGGTCCAAGATCGAACGCAGGAAGATCATGGAGCAGTCTCCGGACATGCA
CAACGCCGAGATCTCCAAGAGGCTGGGCAAGCGCTGGAAAATGCTGAAGGACAGCGAGAA
GATCCCGTTCATCCGGGAGGCGGAGCGGCTGCGGCTCAAGCACATGGCCGACTACCCCGA
CTACAAGTACCGGCCCCGGAAAAAGCCCAAAATGGACCCCTCGGCCAAGCCCAGCGCCAG
CCAGAGCCCAGAGAAGAGCGCGGCCGGCGGCGGCGGCGGGAGCGCGGGCGGAGGCGCGGG
CGGTGCCAAGACCTCCAAGGGCTCCAGCAAGAAATGCGGCAAGCTCAAGGCCCCCGCGGC
CGCGGGCGCCAAGGCGGGCGCGGGCAAGGCGGCCCAGTCCGGGGACTACGGGGGCGCGGG
CGACGACTACGTGCTGGGCAGCCTGCGCGTGAGCGGCTCGGGCGGCGGCGGCGCGGGCAA
GACGGTCAAGTGCGTGTTTCTGGATGAGGACGACGACGACGACGACGACGACGACGAGCT
GCAGCTGCAGATCAAACAGGAGCCGGACGAGGAGGACGAGGAACCACCGCACCAGCAGCT
CCTGCAGCCGCCGGGGCAGCAGCCGTCGCAGCTGCTGAGACGCTACAACGTCGCCAAAGT
GCCCGCCAGCCCTACGCTGAGCAGCTCGGCGGAGTCCCCCGAGGGAGCGAGCCTCTACGA
CGAGGTGCGGGCCGGCGCGACCTCGGGCGCCGGGGGCGGCAGCCGCCTCTACTACAGCTT
CAAGAACATCACCAAGCAGCACCCGCCGCCGCTCGCGCAGCCCGCGCTGTCGCCCGCGTC
CTCGCGCTCGGTGTCCACCTCCTCGTCCAGCAGCAGCGGCAGCAGCAGCGGCAGCAGCGG
CGAGGACGCCGACGACCTGATGTTCGACCTGAGCTTGAATTTCTCTCAAAGCGCGCACAG
CGCCAGCGAGCAGCAGCTGGGGGGCGGCGCGGCGGCCGGGAACCTGTCCCTGTCGCTGGT
GGATAAGGATTTGGATTCGTTCAGCGAGGGCAGCCTGGGCTCCCACTTCGAGTTCCCCGA
CTACTGCACGCCGGAGCTGAGCGAGATGATCGCGGGGGACTGGCTGGAGGCGAACTTCTC
CGACCTGGTGTTCACATATTGAAAGGCGCCCGCTGCTCGCTCTTTCTCTCGGAGGGTGCA
GAGCTGGGTTCCTTGGGAGGAAGTTGTAGTGGT
Tag Tag Free
ACCN NM_003108
ORF Size 1326 bp
Insert Size 1400
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003108.3.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003108.3, NP_003099
RefSeq Size 8737
Locus ID 6664
Cytogenetics 2p25.2
Protein Families ES Cell Differentiation/IPS, Induced pluripotent stem cells
Gene Summary This intronless gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may function in the developing nervous system and play a role in tumorigenesis. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.