MASPIN (SERPINB5) (NM_002639) Human Untagged Clone

SKU
SC303231
SERPINB5 (untagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5)
$457.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol MASPIN
Synonyms maspin; PI5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002639 edited
TTTTCCAGGATAACTGTGACTCCAGGCCCGCAATGGATGCCCTGCAACTAGCAAATTCGG
CTTTTGCCGTTGATCTGTTCAAACAACTATGTGAAAAGGAGCCACTGGGCAATGTCCTCT
TCTCTCCAATCTGTCTCTCCACCTCTCTGTCACTTGCTCAAGTGGGTGCTAAAGGTGACA
CTGCAAATGAAATTGGACAGGTTCTTCATTTTGAAAATGTCAAAGATGTACCCTTTGGAT
TTCAAACAGTAACATCGGATGTAAACAAACTTAGTTCCTTTTACTCACTGAAACTAATCA
AGCGGCTCTACGTAGACAAATCTCTGAATCTTTCTACAGAGTTCATCAGCTCTACGAAGA
GACCCTATGCAAAGGAATTGGAAACTGTTGACTTCAAAGATAAATTGGAAGAAACGAAAG
GTCAGATCAACAACTCAATTAAGGATCTCACAGATGGCCACTTTGAGAACATTTTAGCTG
ACAACAGTGTGAACGACCAGACCAAAATCCTTGTGGTTAATGCTGCCTACTTTGTTGGCA
AGTGGATGAAGAAATTTCCTGAATCAGAAACAAAAGAATGTCCTTTCAGAGTCAACAAGA
CAGACACCAAACCAGTGCAGATGATGAACATGGAGGCCACGTTCTGTATGGGAAACATTG
ACAGTATCAATTGTAAGATCATAGAGCTTCCTTTTCAAAATAAGCATCTCAGCATGTTCA
TCCTACTACCCAAGGATGTGGAGGATGAGTCCACAGGCTTGGAGAAGATTGAAAAACAAC
TCAACTCAGAGTCACTGTCACAGTGGACTAATCCCAGCACCATGGCCAATGCCAAGGTCA
AACTCTCCATTCCAAAATTTAAGGTGGAAAAGATGATTGATCCCAAGGCTTGTCTGGAAA
ATCTAGGGCTGAAACATATCTTCAGCGAAGACACATCTGATTTCTCTGGAATGTCAGAGA
CCAAGGGAGTGGCCCTATCAAATGTTGTCCACAAAGTGTGCTTAGAAATAACTGAAGATG
GTGGGGATTCCATAGAGGTGCCAGGAGCACGGATCCTGCAGCACAAGGATGAATTGAATG
CTGACCATCCCTTTATTTACATCATCAGGCACAACAAAACTCGAAACATCATTTTCTTTG
GCAAATTCTGTTCTCCTTAAGTGGCATAGCCCATGTTAAGTCCTCCCTGACTTTCTC
Restriction Sites Please inquire
ACCN NM_002639
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a good match to NM_002639.2 except for 3 SNPs.
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002639.2, NP_002630.1
RefSeq Size 2558 bp
RefSeq ORF 1128 bp
Locus ID 5268
UniProt ID P36952
Cytogenetics 18q21.33
Protein Families Druggable Genome, Secreted Protein
Protein Pathways p53 signaling pathway
Summary Tumor suppressor. It blocks the growth, invasion, and metastatic properties of mammary tumors. As it does not undergo the S (stressed) to R (relaxed) conformational transition characteristic of active serpins, it exhibits no serine protease inhibitory activity.[UniProtKB/Swiss-Prot Function]
Write Your Own Review
You're reviewing:MASPIN (SERPINB5) (NM_002639) Human Untagged Clone
Your Rating
SKU Description Size Price
RC224287 SERPINB5 (Myc-DDK-tagged)-Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5) 10 ug
$457.00
RC224287L1 Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5), Myc-DDK-tagged 10 ug
$757.00
RC224287L2 Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5), mGFP tagged 10 ug
$757.00
RC224287L3 Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5), Myc-DDK-tagged 10 ug
$757.00
RC224287L4 Lenti ORF clone of Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5), mGFP tagged 10 ug
$757.00
RG224287 SERPINB5 (tGFP-tagged) - Human serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5) 10 ug
$489.00 MSRP $657.00 MSRP $657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.