HOXB1 (NM_002144) Human Untagged Clone
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | HOXB1 |
Synonyms | HCFP3; Hox-2.9; HOX2; HOX2I |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_002144 edited
ATGGACTATAATAGGATGAACTCCTTCTTAGAGTACCCACTCTGTAACCGGGGACCCAGC GCCTACAGCGCCCACAGCGCCCCAACCTCCTTTCCCCCAAGCTCGGCTCAGGCGGTTGAC AGCTATGCAAGCGAGGGCCGCTACGGTGGGGGGCTGTCCAGCCCTGCGTTTCAGCAGAAC TCCGGCTATCCCGCCCAGCAGCCGCCTTCGACCCTGGGGGTGCCCTTCCCCAGCTCCGCG CCCTCGGGGTATGCTCCTGCCGCCTGCAGCCCCAGCTACGGGCCTTCTCAGTACTACCCT CTGGGTCAATCAGAAGGAGACGGAGGCTATTTTCATCCCTCGAGCTACGGGGCCCAGCTA GGGGGCTTGTCCGATGGCTACGGAGCAGGTGGAGCCGGTCCGGGGCCATATCCTCCGCAG CATCCCCCTTATGGGAACGAGCAGACCGCGAGCTTTGCACCGGCCTATGCTGATCTCCTC TCCGAGGACAAGGAAACACCCTGCCCTTCAGAACCTAACACCCCCACGGCCCGGACCTTC GACTGGATGAAGGTTAAGAGAAACCCACCCAAGACAGCGAAGGTGTCAGAGCCAGGCCTG GGCTCGCCCAGTGGCCTCCGCACCAACTTCACCACAAGGCAGCTGACAGAACTGGAAAAG GAGTTCCATTTCAACAAGTACCTGAGCCGGGCCCGGAGGGTGGAGATTGCCGCCACCCTG GAGCTCAATGAAACACAGGTCAAGATTTGGTTCCAGAACCGACGAATGAAGCAGAAGAAG CGCGAGCGAGAGGAAGGTCGGGTCCCCCCAGCCCCACCAGGCTGCCCCAAGGAGGCAGCT GGAGATGCCTCAGACCAGTCGACATGCACCTCCCCGGAAGCCTCACCCAGCTCTGTCACC TCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_002144 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002144.3, NP_002135.2 |
RefSeq Size | 1014 bp |
RefSeq ORF | 906 bp |
Locus ID | 3211 |
UniProt ID | P14653 |
Cytogenetics | 17q21.32 |
Protein Families | Transcription Factors |
Gene Summary | This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXB genes located in a cluster on chromosome 17. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214217 | HOXB1 (Myc-DDK-tagged)-Human homeobox B1 (HOXB1) |
USD 450.00 |
|
RC214217L1 | Lenti ORF clone of Human homeobox B1 (HOXB1), Myc-DDK-tagged |
USD 750.00 |
|
RC214217L2 | Lenti ORF clone of Human homeobox B1 (HOXB1), mGFP tagged |
USD 750.00 |
|
RC214217L3 | Lenti ORF clone of Human homeobox B1 (HOXB1), Myc-DDK-tagged |
USD 750.00 |
|
RC214217L4 | Lenti ORF clone of Human homeobox B1 (HOXB1), mGFP tagged |
USD 750.00 |
|
RG214217 | HOXB1 (tGFP-tagged) - Human homeobox B1 (HOXB1) |
USD 650.00 |
{0} Product Review(s)
Be the first one to submit a review