FGF9 (NM_002010) Human Untagged Clone
CAT#: SC303107
FGF9 (untagged)-Human fibroblast growth factor 9 (glia-activating factor) (FGF9)
"NM_002010" in other vectors (6)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FGF9 |
Synonyms | FGF-9; GAF; HBFG-9; HBGF-9; SYNS3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_002010, the custom clone sequence may differ by one or more nucleotides
ATGGCTCCCTTAGGTGAAGTTGGGAACTATTTCGGTGTGCAGGATGCGGTACCGTTTGGGAATGTGCCCG TGTTGCCGGTGGACAGCCCGGTTTTGTTAAGTGACCACCTGGGTCAGTCCGAAGCAGGGGGGCTCCCCAG GGGACCCGCAGTCACGGACTTGGATCATTTAAAGGGGATTCTCAGGCGGAGGCAGCTATACTGCAGGACT GGATTTCACTTAGAAATCTTCCCCAATGGTACTATCCAGGGAACCAGGAAAGACCACAGCCGATTTGGCA TTCTGGAATTTATCAGTATAGCAGTGGGCCTGGTCAGCATTCGAGGCGTGGACAGTGGACTCTACCTCGG GATGAATGAGAAGGGGGAGCTGTATGGATCAGAAAAACTAACCCAAGAGTGTGTATTCAGAGAACAGTTC GAAGAAAACTGGTATAATACGTACTCATCAAACCTATATAAGCACGTGGACACTGGAAGGCGATACTATG TTGCATTAAATAAAGATGGGACCCCGAGAGAAGGGACTAGGACTAAACGGCACCAGAAATTCACACATTT TTTACCTAGACCAGTGGACCCCGACAAAGTACCTGAACTGTATAAGGATATTCTAAGCCAAAGTTGA |
Restriction Sites | Please inquire |
ACCN | NM_002010 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002010.1, NP_002001.1 |
RefSeq Size | 1420 bp |
RefSeq ORF | 627 bp |
Locus ID | 2254 |
UniProt ID | P31371 |
Cytogenetics | 13q12.11 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton |
Gene Summary | The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein was isolated as a secreted factor that exhibits a growth-stimulating effect on cultured glial cells. In nervous system, this protein is produced mainly by neurons and may be important for glial cell development. Expression of the mouse homolog of this gene was found to be dependent on Sonic hedgehog (Shh) signaling. Mice lacking the homolog gene displayed a male-to-female sex reversal phenotype, which suggested a role in testicular embryogenesis. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210242 | FGF9 (Myc-DDK-tagged)-Human fibroblast growth factor 9 (glia-activating factor) (FGF9) |
USD 300.00 |
|
RC210242L1 | Lenti ORF clone of Human fibroblast growth factor 9 (glia-activating factor) (FGF9), Myc-DDK-tagged |
USD 600.00 |
|
RC210242L2 | Lenti ORF clone of Human fibroblast growth factor 9 (glia-activating factor) (FGF9), mGFP tagged |
USD 600.00 |
|
RC210242L3 | Lenti ORF clone of Human fibroblast growth factor 9 (glia-activating factor) (FGF9), Myc-DDK-tagged |
USD 600.00 |
|
RC210242L4 | Lenti ORF clone of Human fibroblast growth factor 9 (glia-activating factor) (FGF9), mGFP tagged |
USD 600.00 |
|
RG210242 | FGF9 (tGFP-tagged) - Human fibroblast growth factor 9 (glia-activating factor) (FGF9) |
USD 500.00 |
{0} Product Review(s)
Be the first one to submit a review