FGF4 (NM_002007) Human Untagged Clone

CAT#: SC303106

FGF4 (untagged)-Human fibroblast growth factor 4 (FGF4)

USD 402


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name FGF4 (NM_002007) Human Untagged Clone
Symbol FGF4
Synonyms HBGF-4; HST; HST-1; HSTF1; K-FGF; KFGF
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002007 edited
CATGTCGGGGCCCGGGACGGCCGCGGTAGCGCTGCTCCCGGCGGTCCTGCTGGCCTTGCT
GGCGCCCTGGGCGGGCCGAGGGGGCGCCGCCGCACCCACTGCACCCAACGGCACGCTGGA
GGCCGAGCTGGAGCGCCGCTGGGAGAGCCTGGTGGCGCTCTCGTTGGCGCGCCTGCCGGT
GGCAGCGCAGCCCAAGGAGGCGGCCGTCCAGAGCGGCGCCGGCGACTACCTGCTGGGCAT
CAAGCGGCTGCGGCGGCTCTACTGCAACGTGGGCATCGGCTTCCACCTCCAGGCGCTCCC
CGACGGCCGCATCGGCGGCGCGCACGCGGACACCCGCGACAGCCTGCTGGAGCTCTCGCC
CGTGGAGCGGGGCGTGGTGAGCATCTTCGGCGTGGCCAGCCGGTTCTTCGTGGCCATGAG
CAGCAAGGGCAAGCTCTATGGCTCGCCCTTCTTCACCGATGAGTGCACGTTCAAGGAGAT
TCTCCTTCCCAACAACTACAACGCCTACGAGTCCTACAAGTACCCCGGCATGTTCATCGC
CCTGAGCAAGAATGGGAAGACCAAGAAGGGGAACCGAGTGTCGCCCACCATGAAGGTCAC
CCACTTCCTCCCCAGGCTGTGA
Tag Tag Free
ACCN NM_002007
ORF Size 621 bp
Insert Size 600
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002007.1, NP_001998
RefSeq Size 1219
RefSeq ORF 621
Locus ID 2249
Cytogenetics 11q13.3
Protein Families Stem cell relevant signaling - Wnt Signaling pathway, Secreted Protein, ES Cell Differentiation/IPS, Transmembrane, Adult stem cells, Embryonic stem cells, Induced pluripotent stem cells, Druggable Genome
Protein Pathways MAPK signaling pathway, Regulation of actin cytoskeleton, Pathways in cancer, Melanoma
Gene Summary The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This gene was identified by its oncogenic transforming activity. This gene and FGF3, another oncogenic growth factor, are located closely on chromosome 11. Co-amplification of both genes was found in various kinds of human tumors. Studies on the mouse homolog suggested a function in bone morphogenesis and limb development through the sonic hedgehog (SHH) signaling pathway. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations