Flt3 ligand(FLT3LG) (NM_001459) Human Untagged Clone

CAT#: SC303027

FLT3LG (untagged)-Human fms-related tyrosine kinase 3 ligand (FLT3LG), transcript variant 3

USD 402.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Flt3 ligand(FLT3LG) (NM_001459) Human Untagged Clone
Symbol FLT3LG
Synonyms FL; FLT3L
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001459 edited
CCCCTTCCACACCCAACTGGGGCAAGCCTGACCCGGCGACAGGAGGCATGAGGGGCCCCC
GGCCGAAATGACAGTGCTGGCGCCAGCCTGGAGCCCAACGACCTATCTCCTCCTGCTGCT
GCTGCTGAGCTCGGGACTCAGTGGGACCCAGGACTGCTCCTTCCAACACAGCCCCATCTC
CTCCGACTTCGCTGTCAAAATCCGTGAGCTGTCTGACTACCTGCTTCAAGATTACCCAGT
CACCGTGGCCTCCAACCTGCAGGACGAGGAGCTCTGCGGGGGCCTCTGGCGGCTGGTCCT
GGCACAGCGCTGGATGGAGCGGCTCAAGACTGTCGCTGGGTCCAAGATGCAAGGCTTGCT
GGAGCGCGTGAACACGGAGATACACTTTGTCACCAAATGTGCCTTTCAGCCCCCCCCCAG
CTGTCTTCGCTTCGTCCAGACCAACATCTCCCGCCTCCTGCAGGAGACCTCCGAGCAGCT
GGTGGCGCTGAAGCCCTGGATCACTCGCCAGAACTTCTCCCGGTGCCTGGAGCTGCAGTG
TCAGCCCGACTCCTCAACCCTGCCACCCCCATGGAGTCCCCGGCCCCTGGAGGCCACAGC
CCCGACAGCCCCGCAGCCCCCTCTGCTCCTCCTACTGCTGCTGCCCGTGGGCCTCCTGCT
GCTGGCCGCTGCCTGGTGCCTGCACTGGCAGAGGACGCGGCGGAGGACACCCCGCCCTGG
GGAGCAGGTGCCCCCCGTCCCCAGTCCCCAGGACCTGCTGCTTGTGGAGCACTGACCTGG
CCAAGGCCTCATCCTGGGGAGGATACTGAGGCACACAGAGGGGAGTCACCAGCCAGAGGA
TGCATAGCCTGGACACAGAGGAAGTTGGCTAGAGGCCGGTCCCTTCCTTGGGCCCCTCTC
ATTCCCTCCCCAGAATGGAGGCAACGCCAGAAT
Tag Tag Free
ACCN NM_001459
ORF Size 708 bp
Insert Size 900
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001459.2.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001459.2, NP_001450
RefSeq Size 1056
Locus ID 2323
Cytogenetics 19q13.33
Protein Families Secreted Protein, ES Cell Differentiation/IPS, Transmembrane, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Pathways in cancer
Gene Summary Dendritic cells (DCs) provide the key link between innate and adaptive immunity by recognizing pathogens and priming pathogen-specific immune responses. FLT3LG controls the development of DCs and is particularly important for plasmacytoid DCs and CD8 (see MIM 186910)-positive classical DCs and their CD103 (ITGAE; MIM 604682)-positive tissue counterparts (summary by Sathaliyawala et al., 2010 [PubMed 20933441]).[supplied by OMIM, Jan 2011].
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.