VEGFA (NM_001025370) Human Untagged Clone

CAT#: SC302398

VEGFA (untagged)-Human vascular endothelial growth factor A (VEGFA), transcript variant 6

USD 618.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name VEGFA (NM_001025370) Human Untagged Clone
Symbol VEGFA
Synonyms MVCD1; VEGF; VPF
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001025370 edited
GTCGTGGCGCTGGGGGCTAGCACCAGCGCTCTGTCGGGAGGCGCAGCGGTTAGGTGGACC
GGTCAGCGGACTCACCGGCCAGGGCGCTCGGTGCTGGAATTTGATATTCATTGATCCGGG
TTTTATCCCTCTTCTTTTTTCTTAAACATTTTTTTTTAAAACTGTATTGTTTCTCGTTTT
AATTTATTTTTGCTTGCCATTCCCCACTTGAATCGGGCCGACGGCTTGGGGAGATTGCTC
TACTTCCCCAAATCACTGTGGATTTTGGAAACCAGCAGAAAGAGGAAAGAGGTAGCAAGA
GCTCCAGAGAGAAGTCGAGGAAGAGAGAGACGGGGTCAGAGAGAGCGCGCGGGCGTGCGA
GCAGCGAAAGGGACAGGGGCAAAGTGAGTGACCTGCTTTTGGGGGTGACCGCCGGAGCGC
GGCGTGAGCCCTCCCCCTTGGGATCCCGCAGCTGACCAGTCGCGCTGACGGACAGACAGA
CAGACACCGCCCCCAGCCCCAGCTACCACCTCCTCCCCGGCCGGCGGCGGACAGTGGACG
CGGCGGCGAGCCGCGGGCAGGGGCCGGAGCCCGCGCCCGGAGGCGGGGTGGAGGGGGTCG
GGGCTCGCGGCGTCGCACTGAAACTTTTCGTCCAACTTCTGGGCTGTTCTCGCTTCGGAG
GAGCCGTGGTCCGCGCGGGGGAAGCCGAGCCGAGCGGAGCCGCGAGAAGTGCTAGCTCGG
GCCGGGAGGAGCCGCAGCCGGAGGAGGGGGAGGAGGAAGAAGAGAAGGAAGAGGAGAGGG
GGCCGCAGTGGCGACTCGGCGCTCGGAAGCCGGGCTCATGGACGGGTGAGGCGGCGGTGT
GCGCAGACAGTGCTCCAGCCGCGCGCGCTCCCCAGGCCCTGGCCCGGGCCTCGGGCCGGG
GAGGAAGAGTAGCTCGCCGAGGCGCCGAGGAGAGCGGGCCGCCCCACAGCCCGAGCCGGA
GAGGGAGCGCGAGCCGCGCCGGCCCCGGTCGGGCCTCCGAAACCATGAACTTTCTGCTGT
CTTGGGTGCATTGGAGCCTTGCCTTGCTGCTCTACCTCCACCATGCCAAGTGGTCCCAGG
CTGCACCCATGGCAGAAGGAGGAGGGCAGAATCATCACGAAGTGGTGAAGTTCATGGATG
TCTATCAGCGCAGCTACTGCCATCCAATCGAGACCCTGGTGGACATCTTCCAGGAGTACC
CTGATGAGATCGAGTACATCTTCAAGCCATCCTGTGTGCCCCTGATGCGATGCGGGGGCT
GCTGCAATGACGAGGGCCTGGAGTGTGTGCCCACTGAGGAGTCCAACATCACCATGCAGA
TTATGCGGATCAAACCTCACCAAGGCCAGCACATAGGAGAGATGAGCTTCCTACAGCACA
ACAAATGTGAATGCAGACCAAAGAAAGATAGAGCAAGACAAGAAAAATGTGACAAGCCGA
GGCGGTGA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001025370 unedited
NNNGGGCCATGGGGATGGCAACTTCCAGGGCCAGNANGAGCACTGGGGNAGGGTCACAGG
GATGCCACCCGGGATCTGTTCAGGAAAAGCTATGACCGCGGCCGCAATCTAGCTACAGGA
ATCCCAGAAATAAAACTCTCTAATCTTCCGGGCTCGGTGATTTAGCAGCAAGAAAAATAA
AATGGCGAATCCAATTCCAAGAGGGACCGTGCTGGGTCACCCGCCCGGGAATGCTTCCGC
CGGAGTCTCGCCCTCCGGACCCAAAGTGCTCTGCGCAGAGTCTCCTCTTCCTTCATTTCA
GGTTTCTGGATTAAGGACTGTTCTGTCGATGGTGATGGTGTGGTGGCGGCAGCGTGGTTT
CTGTATCGATCGTTCTGTATCAGTCTTTCCTGGTGAGAGATCTGGTTCCCGAAACCCTGA
GGGAGGCTCCTTCCTCCTGCCCGGCTCACCGCCTCGGCTTGTCACATTTTTCTTGTCTTG
CTCTATCTTTCTTTGGTCTGCATTCACATTTGTTGTGCTGTAGGAAGCTCATCTCTCCTA
TGTGCTGGCCTTGGTGAGGTTTGATCCGCATAATCTGCATGGTGATGTTGGACTCCTCAG
TGGGCACACACTCCAGGCCCTCGTCATTGCAGCAGCCCCCGCATCGCATCAGGGGCACAC
AGGATGGCTTGAAGATGTACTCGATCTCATCAGGGTACTCCTGGGAGATGTCCACCAAGG
TCTCGATTGGATGGCAGTAGCTGCGCTGGTAGACATCCATGGACCTTCACCACTTCGTGA
AGGATCTGCCCCCCCTCCTTCTGCCATGGGGTGCAGCCTGGGGCCACTTGGCATGGGGGG
AGGTAGAACAACCAGGGAAGGGGTCCAAAGCCACCAAGAA
Tag Tag Free
ACCN NM_001025370
ORF Size 984 bp
Insert Size 2100
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone is found to be a perfect match to NM_001025370.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001025370.1, NP_001020541
RefSeq Size 3410
Locus ID 7422
Cytogenetics 6p21.1
Protein Families Secreted Protein, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, mTOR signaling pathway, VEGF signaling pathway, Focal adhesion, Pathways in cancer, Renal cell carcinoma, Pancreatic cancer, Bladder cancer
Gene Summary This gene is a member of the PDGF/VEGF growth factor family. It encodes a heparin-binding protein, which exists as a disulfide-linked homodimer. This growth factor induces proliferation and migration of vascular endothelial cells, and is essential for both physiological and pathological angiogenesis. Disruption of this gene in mice resulted in abnormal embryonic blood vessel formation. This gene is upregulated in many known tumors and its expression is correlated with tumor stage and progression. Elevated levels of this protein are found in patients with POEMS syndrome, also known as Crow-Fukase syndrome. Allelic variants of this gene have been associated with microvascular complications of diabetes 1 (MVCD1) and atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been described. There is also evidence for alternative translation initiation from upstream non-AUG (CUG) codons resulting in additional isoforms. A recent study showed that a C-terminally extended isoform is produced by use of an alternative in-frame translation termination codon via a stop codon readthrough mechanism, and that this isoform is antiangiogenic. Expression of some isoforms derived from the AUG start codon is regulated by a small upstream open reading frame, which is located within an internal ribosome entry site. [provided by RefSeq, Nov 2015].
Transcript Variant: This variant (6) lacks two alternate in-frame exons in the 3' coding region, compared to variant 1. This variant can initiate translation from four non-AUG (CUG) sites, and also from a downstream, in-frame AUG. The isoform (f) represented in this RefSeq is derived from the 5'-most CUG start codon, and is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.