KK LC 1 (CT83) (NM_001017978) Human Untagged Clone
CAT#: SC302102
CXorf61 (untagged)-Human chromosome X open reading frame 61 (CXorf61)
"NM_001017978" in other vectors (7)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | KK LC 1 |
Synonyms | CXorf61; KK-LC-1; KKLC1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001017978 edited
GGGGAGTTACACCAGGCATCCTGGCCCAAAGTTTCCCAAATCCAGGCGGCTAGAGGCCCA CTGCTTCCCAACTACCAGCTGAGGGGGTCCGTCCCGAGAAGGGAGAAGAGGCCGAAGAGG AAACATGAACTTCTATTTACTCCTAGCGAGCAGCATTCTGTGTGCCTTGATTGTCTTCTG GAAATATCGCCGCTTTCAGAGAAACACTGGCGAAATGTCATCAAATTCAACTGCTCTTGC ACTAGTGAGACCCTCTTCTTCTGGGTTAATTAACAGCAATACAGACAACAATCTTGCAGT CTACGACCTCTCTCGGGATATTTTAAATAATTTCCCACACTCAATAGCCAGGCAGAAGCG AATATTGGTAAACCTCAGTATGGTGGAAAACAAGCTGGTTGAACTGGAACATACTCTACT TAGCAAGGGTTTCAGAGGTGCATCACCTCACCGGAAATCCACCTAAAAGCGTACAGGATG TAATGCCAGTGGTGGAAATCATTAAAGACACTTTGAGTAGATCCAAAAAAAAAAAAAAAA AAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001017978 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone is found to be a perfect match to NM_001017978.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001017978.1, NP_001017978.1 |
RefSeq Size | 552 bp |
RefSeq ORF | 342 bp |
Locus ID | 203413 |
UniProt ID | Q5H943 |
Cytogenetics | Xq23 |
Protein Families | Transmembrane |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209391 | CXorf61 (Myc-DDK-tagged)-Human chromosome X open reading frame 61 (CXorf61) |
USD 150.00 |
|
RC209391L1 | Lenti ORF clone of Human chromosome X open reading frame 61 (CXorf61), Myc-DDK-tagged |
USD 450.00 |
|
RC209391L2 | Lenti ORF clone of Human chromosome X open reading frame 61 (CXorf61), mGFP tagged |
USD 450.00 |
|
RC209391L3 | Lenti ORF clone of Human chromosome X open reading frame 61 (CXorf61), Myc-DDK-tagged |
USD 450.00 |
|
RC209391L4 | Lenti ORF clone of Human chromosome X open reading frame 61 (CXorf61), mGFP tagged |
USD 450.00 |
|
RG209391 | CXorf61 (tGFP-tagged) - Human chromosome X open reading frame 61 (CXorf61) |
USD 350.00 |
|
SC321038 | CXorf61 (untagged)-Human chromosome X open reading frame 61 (CXorf61) |
USD 150.00 |
{0} Product Review(s)
Be the first one to submit a review