CXCR4 (NM_001008540) Human Untagged Clone

CAT#: SC301321

CXCR4 (untagged)-Human chemokine (C-X-C motif) receptor 4 (CXCR4), transcript variant 1

USD 577


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CXCR4 (NM_001008540) Human Untagged Clone
Symbol CXCR4
Synonyms CD184; D2S201E; FB22; HM89; HSY3RR; LAP-3; LAP3; LCR1; LESTR; NPY3R; NPYR; NPYRL; NPYY3R; WHIM
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001008540 edited
ATGTCCATTCCTTTGCCTCTTTTGCAGATATACACTTCAGATAACTACACCGAGGAAATG
GGCTCAGGGGACTATGACTCCATGAAGGAACCCTGTTTCCGTGAAGAAAATGCTAATTTC
AATAAAATCTTCCTGCCCACCATCTACTCCATCATCTTCTTAACTGGCATTGTGGGCAAT
GGATTGGTCATCCTGGTCATGGGTTACCAGAAGAAACTGAGAAGCATGACGGACAAGTAC
AGGCTGCACCTGTCAGTGGCCGACCTCCTCTTTGTCATCACGCTTCCCTTCTGGGCAGTT
GATGCCGTGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTAC
ACAGTCAACCTCTACAGCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTG
GCCATCGTCCACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGCTGAAAAGGTGGTC
TATGTTGGCGTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCAAC
GTCAGTGAGGCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTG
GTTGTGTTCCAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTG
TCCTGCTATTGCATTATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAG
GCCCTCAAGACCACAGTCATCCTCATCCTGGCTTTCTTCGCCTGTTGGCTGCCTTACTAC
ATTGGGATCAGCATCGACTCCTTCATCCTCCTGGAAATCATCAAGCAAGGGTGTGAGTTT
GAGAACACTGTGCACAAGTGGATTTCCATCACCGAGGCCCTAGCTTTCTTCCACTGTTGT
CTGAACCCCATCCTCTATGCTTTCCTTGGAGCCAAATTTAAAACCTCTGCCCAGCACGCA
CTCACCTCTGTGAGCAGAGGGTCCAGCCTCAAGATCCTCTCCAAAGGAAAGCGAGGTGGA
CATTCATCTGTTTCCACTGAGTCTGAGTCTTCAAGTTTTCACTCCAGCTAACACAGATGT
AAAAGACTTTTTTTTATACGATAAATAACTTTTTTTTAAGTTACACATTTTTCAGATATA
AAAGACTGACCAATATTGTACAGTTTTTATTGCTTGTTGGATTTTTGTCTTGTGTTTCTT
TAGTTTTTGTGAAGTTTAATTGACTTATTTATATAAATTTTTTTTGTTTCATATTGATGT
GTGTCTAGGCAGGACCTGTGGCCAAGTTCTTAGTTGCTGTATGTCTCGTGGTAGGACTGT
AGAAAAGGGAACTGAACATTCCAGAGCGTGTAGTGAATCACGTAAAGCTAGAAATGATCC
CCAGCTGTTTATGCATAGATAATCTCTCCATTCCCGTGGAACGTTTTTCCTGTTCTTAAG
ACGTGATTTTGCTGTAGAAGATGGCACTTATAACCAAAGCCCAAAGTGGTATAGAAATGC
TGGTTTTTCAGTTTTCAGGAGTGGGTTGATTTCAGCACCTACAGTGTACAGTCTTGTATT
AAGTTGTTAATAAAAGTACATGTTAAACTTAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001008540 unedited
NGAGTCAGATTTGTATACCATCACTATAGGCGGCCGCGAATTCGCACGAGGATGTCCATT
CCTTTGCCTCTTTTGCAGATATACACTTCAGATAACTACACCGAGGAAATGGGCTCAGGG
GACTATGACTCCATGAAGGAACCCTGTTTCCGTGAAGAAAATGCTAATTTCAATAAAATC
TTCCTGCCCACCATCTACTCCATCATCTTCTTAACTGGCATTGTGGGCAATGGATTGGTC
ATCCTGGTCATGGGTTACCAGAAGAAACTGAGAAGCATGACGGACAAGTACAGGCTGCAC
CTGTCAGTGGCCGACCTCCTCTTTGTCATCACGCTTCCCTTCTGGGCAGTTGATGCCGTG
GCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGTCAAC
CTCTACAGCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTGGCCATCGTC
CACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGCTGAAAAGGTGGTCTATGTTGGC
GTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCAACGTCAGTGAG
GCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTT
CAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTAT
TGCATTATCATCTCCAAGCTGTCACACTCCCAAGGCCACCAGAAGCGCCAGGCCCCTCAA
ACCACAGTCATCCTCATCCTGGNCTTCTTCGCCTGTTGGCTGCCTTACTACNTTGGGATC
AGCATCGACTCCTTCATCCTNCTGGAAATCATCAAGCAGGGTGTGAGTTTGAGACACTG
3' Read Nucleotide Sequence
>Forward primer walk for NM_001008540 unedited
AATGAAGCAATATCTGTGACCGCTTCTACCCCATGACTTGTGGGTGGTTGTGTTCCAGTT
TCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGCAT
TATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACCAC
AGTCATCCTCATCCTGGCTTTCTTCGCCTGTTGGCTGCCTTACTACATTGGGATCAGCAT
CGACTCCTTCATCCTCCTGAAAATCATCAAGCAAGGGTGTGAGTTTGAGAACACTGTGCA
CAAGTGGATTTCCATCACCGAGGCCCTAGCTTTCTTCCACTGTTGTCTGAACCCCATCCT
CTATGCTTTCCTTGGAGCCAAATTTAAAACCTCTGCCCAGCACGCACTCACCTCTGTGAG
CAGAGGGTCCAGCCTCAAGATCCTCTCCAAAGGAAAGCGAGGTGGACATTCATCTGTTTC
CACTGAACTCTGAGTCTTCAAGTTTTCACTCCAGCTAACACAGATGTAAACAAATTTTTT
TTAATCGAAAAATAACCTTTTTTGTAAGAAAAACATTTCCGAAACCCAAACCACGGCCGA
GTATAGACACGATTACAACGGGCGAAAGAACACAGAACAAAAGACCACCAAAAGAACGAA
AAAGGGAAAAACACCAACAGTAGAAAAAAGCAGCCCCCAACAACAAAAAAAACACAACGA
CCCCGACCACCGAAAGCAAACCAACAAAACCAAGGAAGGCGAAAAACCCACCCCACAAAA
AGTACACTAATTAAGAAACACCCACCCCACCACACCCC
Tag Tag Free
ACCN NM_001008540
ORF Size 1071 bp
Insert Size 1600
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001008540.1, NP_001008540
RefSeq Size 1912
RefSeq ORF 1071
Locus ID 7852
Cytogenetics 2q22.1
Protein Families GPCR, ES Cell Differentiation/IPS, Transmembrane, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction, Chemokine signaling pathway, Endocytosis, Axon guidance, Leukocyte transendothelial migration
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations