IL3 (NM_000588) Human Untagged Clone

SKU SC300103

IL3 (untagged)-Human interleukin 3 (colony-stimulating factor, multiple) (IL3)

Product Data

• Type: Human Untagged Clone
• Target Symbol: IL3
• Synonyms: IL-3; MCGF; MULTI-CSF
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene sequence for NM_000588 edited; GCCCCACGAAGGACCAGAACAAGACAGAGTGCCTCCTGCCGATCCAAACATGAGCCGCCT; GCCCGTCCTGCTCCTGCTCCAACTCCTGGTCCGCCCCGGACTCCAAGCTCCCATGACCCA; GACAACGCCCTTGAAGACAAGCTGGGTTAACTGCTCTAACATGATCGATGAAATTATAAC; ACACTTAAAGCAGCCACCTTTGCCTTTGCTGGACTTCAACAACCTCAATGGGGAAGACCA; AGACATTCTGATGGAAAATAACCTTCGAAGGCCAAACCTGGAGGCATTCAACAGGGCTGT; CAAGAGTTTACAGAACGCATCAGCAATTGAGAGCATTCTTAAAAATCTCCTGCCATGTCT; GCCCCTGGCCACGGCCGCACCCACGCGACATCCAATCCATATCAAGGACGGTGACTGGAA; TGAATTCCGGAGGAAACTGACGTTCTATCTGAAAACCCTTGAGAATGCGCAGGCTCAACA; GACGACTTTGAGCCTCGCGATCTTTTGAGTCCAACGTCCAGCTCGTTCTCTGGGCCTTCT; CACCACAGAGCCTCGGG;
• Restriction Sites: Please inquire
• ACCN: NM_000588
• Insert Size: 600 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• OTI Annotation: The ORF of this clone is found to be a perfect match to NM_000588.3.
• Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution Method: 1. Centrifuge at 5,000xg for 5min.; 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.; 3. Close the tube and incubate for 10 minutes at room temperature.; 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.; 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
• Note: Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required.
• Shipping: Ambient

Reference Data

• RefSeq: NM_000588.3, NP_000579.2
• RefSeq Size: 924 bp
• RefSeq ORF: 459 bp
• Locus ID: 3562
• UniProt ID: P08700
• Cytogenetics: 5q31.1
• Protein Families: Druggable Genome, Secreted Protein
• Protein Pathways: Apoptosis, Asthma, Cytokine-cytokine receptor interaction, Fc epsilon RI signaling pathway, Hematopoietic cell lineage, Jak-STAT signaling pathway
• Summary: The protein encoded by this gene is a potent growth promoting cytokine. This cytokine is capable of supporting the proliferation of a broad range of hematopoietic cell types. It is involved in a variety of cell activities such as cell growth, differentiation and apoptosis. This cytokine has been shown to also possess neurotrophic activity, and it may be associated with neurologic disorders. [provided by RefSeq, Jul 2008]