Thrombopoietin(THPO) (NM_000460) Human Untagged Clone

CAT#: SC300074

THPO (untagged)-Human thrombopoietin (THPO), transcript variant 1

USD 721


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Thrombopoietin(THPO) (NM_000460) Human Untagged Clone
Symbol THPO
Synonyms MGDF; MKCSF; ML; MPLLG; THCYT1; TPO
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000460 edited
CCTACCCATCTGCTCCCCAGAGGGCTGCCTGCTGTGCACTTGGGTCCTGGAGCCCTTCTC
CACCCGGATAGATTCCTCACCCTTGGCCCGCCTTTGCCCCACCCTACTCTGCCCAGAAGT
GCAAGAGCCTAAGCCGCCTCCATGGCCCCAGGAAGGATTCAGGGGAGAGGCCCCAAACAG
GGAGCCACGCCAGCCAGACACCCCGGCCAGAATGGAGCTGACTGAATTGCTCCTCGTGGT
CATGCTTCTCCTAACTGCAAGGCTAACGCTGTCCAGCCCGGCTCCTCCTGCTTGTGACCT
CCGAGTCCTCAGTAAACTGCTTCGTGACTCCCATGTCCTTCACAGCAGACTGAGCCAGTG
CCCAGAGGTTCACCCTTTGCCTACACCTGTCCTGCTGCCTGCTGTGGACTTTAGCTTGGG
AGAATGGAAAACCCAGATGGAGGAGACCAAGGCACAGGACATTCTGGGAGCAGTGACCCT
TCTGCTGGAGGGAGTGATGGCAGCACGGGGACAACTGGGACCCACTTGCCTCTCATCCCT
CCTGGGGCAGCTTTCTGGACAGGTCCGTCTCCTCCTTGGGGCCCTGCAGAGCCTCCTTGG
AACCCAGCTTCCTCCACAGGGCAGGACCACAGCTCACAAGGATCCCAATGCCATCTTCCT
GAGCTTCCAACACCTGCTCCGAGGAAAGGTGCGTTTCCTGATGCTTGTAGGAGGGTCCAC
CCTCTGCGTCAGGCGGGCCCCACCCACCACAGCTGTCCCCAGCAGAACCTCTCTAGTCCT
CACACTGAACGAGCTCCCAAACAGGACTTCTGGATTGTTGGAGACAAACTTCACTGCCTC
AGCCAGAACTACTGGCTCTGGGCTTCTGAAGTGGCAGCAGGGATTCAGAGCCAAGATTCC
TGGTCTGCTGAACCAAACCTCCAGGTCCCTGGACCAAATCCCCGGATACCTGAACAGGAT
ACACGAACTCTTGAATGGAACTCGTGGACTCTTTCCTGGACCCTCACGCAGGACCCTAGG
AGCCCCGGACATTTCCTCAGGAACATCAGACACAGGCTCCCTGCCACCCAACCTCCAGCC
TGGATATTCTCCTTCCCCAACCCATCCTCCTACTGGACAGTATACGCTCTTCCCTCTTCC
ACCCACCTTGCCCACCCCTGTGGTCCAGCTCCACCCCCTGCTTCCTGACCCTTCTGCTCC
AACGCCCACCCCTACCAGCCCTCTTCTAAACACATCCTACACCCACTCCCAGAATCTGTC
TCAGGAAGGGTAAGGTTCTCAGACACTGCCGACATCAGCATTGTCTCGTGTACAGCTCCC
TTCCCTGCAGGGCGCCCCTGGGAGACAACTGGACAAGATTTCCTACTTTCTCCTGAAACC
CAAAGCCC
Tag Tag Free
ACCN NM_000460
ORF Size 1062 bp
Insert Size 1400
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000460.1.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000460.2, NP_000451
RefSeq Size 1805
RefSeq ORF 1062
Locus ID 7066
Cytogenetics 3q27.1
Protein Families Secreted Protein, Druggable Genome
Protein Pathways Hematopoietic cell lineage
Gene Summary Lineage-specific cytokine affecting the proliferation and maturation of megakaryocytes from their committed progenitor cells. It acts at a late stage of megakaryocyte development. It may be the major physiological regulator of circulating platelets. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents use of the downstream promoter and comprises six exons. It encodes the main functional protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.