BAX (NM_138761) Human Untagged Clone

CAT#: SC128293

BAX (untagged)-Human BCL2-associated X protein (BAX), transcript variant alpha

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BAX
• Synonyms: BCL2L4
• Vector: pCMV6-XL5
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >OriGene ORF within SC128293 sequence for NM_138761 edited (data generated by NextGen Sequencing)
  ATGGACGGGTCCGGGGAGCAGCCCAGAGGCGGGGGGCCCACCAGCTCTGAGCAGATCATG
  AAGACAGGGGCCCTTTTGCTTCAGGGTTTCATCCAGGATCGAGCAGGGCGAATGGGGGGG
  GAGGCACCCGAGCTGGCCCTGGACCCGGTGCCTCAGGATGCGTCCACCAAGAAGCTGAGC
  GAGTGTCTCAAGCGCATCGGGGACGAACTGGACAGTAACATGGAGCTGCAGAGGATGATT
  GCCGCCGTGGACACAGACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTT
  TCTGACGGCAACTTCAACTGGGGCCGGGTTGTCGCCCTTTTCTACTTTGCCAGCAAACTG
  GTGCTCAAGGCCCTGTGCACCAAGGTGCCGGAACTGATCAGAACCATCATGGGCTGGACA
  TTGGACTTCCTCCGGGAGCGGCTGTTGGACTGGATCCAAGACCAGGGTGGTTGGGACGGC
  CTCCTCTCCTACTTTGGGACGCCCACGTGGCAGACCGTGACCATCTTTGTGGCGGGAGTG
  CTCACCGCCTCACTCACCATCTGGAAGAAGATGGGCTGA
  
  Clone variation with respect to NM_138761.3
  449 g=>a
  5' Read Nucleotide Sequence

  >OriGene 5' read for NM_138761 unedited
  GAGTCGGACTTGTCCTTTGTATACGACTCCTATAGGGCGGCCGCGAATTCGGCACCAGGG
  CCGCCCGCGCGGACCCGGCGAGAGGCGGCGGCGGGAGCGGCGGTGATGGACGGGTCCGGG
  GAGCAGCCCAGAGGCGGGGGGCCCACCAGCTCTGAGCAGATCATGAAGACAGGGGCCCTT
  TTGCTTCAGGGTTTCATCCAGGATCGAGCAGGGCGAATGGGGGGGGAGGCACCCGAGCTG
  GCCCTGGACCCGGTGCCTCAGGATGCGTCCACCAAGAAGCTGAGCGAGTGTCTCAAGCGC
  ATCGGGGACGAACTGGACAGTAACATGGAGCTGCAGAGGATGATTGCCGCCGTGGACACA
  GACTCCCCCCGAGAGGTCTTTTTCCGAGTGGCAGCTGACATGTTTTCTGACGGCAACTTC
  AACTGGGGCCGGGTTGTCGCCCTTTTCTACTTTGCCAGCAAACTGGTGCTCAAGGCCCTG
  TGCACCAAGGTGCCGGAACTGATCAGAACCATCATGGGCTGGACATTGGACTTCCTCCGG
  GAGCGGCTGTTGGGCTGGATCCAAGACCAGGGTGGTTGGGACGGCCTCCTCTCCTACTTT
  GGGACGCCCACGTGGCAGACCGTGACCATCTTTGTGGCGGGAGTGCTCACCGCCTCACTC
  ACCATCTGGAAGAAGATGGGCTGAGGCCCCCAGCTGCCTTGGACTGTGTTTTTCCTCCAT
  AAATTATGGCATTTTTCTGGGAGGGGTGGGGATTGGGGGACATGGGCATTTTTCTTACTT
  TTGTAATTATTGGGGGGTGTGGGGAAGAGTGTCTGAGGGGTAATAAACCTCTCGGGACCC
  CCACCACAACACAAAGAAAAAAAAAAAAAAAAAGACTCCGACCTCATAATGCGACCGAGA
  ATAGCTGTTCCTGAATGGTGCCGGGGTGACATGCGTGTACCGACACCAATTGGCGTGTGC
  ATGACCTGTGGAAGCTG
  
• Restriction Sites: Please inquire
• ACCN: NM_138761
• Insert Size: 1000 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_138761.2, NP_620116.1
• RefSeq Size: 888 bp
• RefSeq ORF: 579 bp
• Locus ID: 581
• UniProt ID: Q07812
• Cytogenetics: 19q13.33
• Protein Families: Druggable Genome, Transmembrane
• Protein Pathways: Amyotrophic lateral sclerosis (ALS), Apoptosis, Colorectal cancer, Huntington's disease, Neurotrophin signaling pathway, p53 signaling pathway, Pathways in cancer, Prion diseases
• Gene Summary: The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein forms a heterodimer with BCL2, and functions as an apoptotic activator. The association and the ratio of BAX to BCL2 also determines survival or death of a cell following an apoptotic stimulus. This protein is reported to interact with, and increase the opening of, the mitochondrial voltage-dependent anion channel (VDAC), which leads to the loss in membrane potential and the release of cytochrome c. The expression of this gene is regulated by the tumor suppressor P53 and has been shown to be involved in P53-mediated apoptosis. Multiple alternatively spliced transcript variants, which encode different isoforms, have been reported for this gene. [provided by RefSeq, Dec 2019]
  Transcript Variant: This variant (alpha) has an alternate splice site in the 3' coding region which causes a frame-shift, compared to variant 1. The resulting isoform (alpha, also known as psi) has a shorter and different C terminus, compared to isoform 1.