TYK2 (NM_003331) Human Untagged Clone

CAT#: SC128128

TYK2 (untagged)-Human tyrosine kinase 2 (TYK2)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TYK2 (NM_003331) Human Untagged Clone
Symbol TYK2
Synonyms IMD35; JTK1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC128128 sequence for NM_003331 edited (data generated by NextGen Sequencing)
ATGCCTCTGCGCCACTGGGGGATGGCCAGGGGCAGTAAGCCCGTTGGGGATGGAGCCCAG
CCCATGGCTGCCATGGGAGGCCTGAAGGTGCTTCTGCACTGGGCTGGTCCAGGCGGCGGG
GAGCCCTGGGTCACTTTCAGTGAGTCATCGCTGACAGCTGAGGAAGTCTGCATCCACATT
GCACATAAAGTTGGTATCACTCCTCCTTGCTTCAATCTCTTTGCCCTCTTCGATGCTCAG
GCCCAAGTCTGGTTGCCCCCAAACCACATCCTAGAGATCCCCAGAGATGCAAGCCTGATG
CTATATTTCCGCATAAGGTTTTATTTCCGGAACTGGCATGGCATGAATCCTCGGGAACCG
GCTGTGTACCGTTGTGGGCCCCCAGGAACCGAGGCATCCTCAGATCAGACAGCACAGGGG
ATGCAACTCCTGGACCCAGCCTCATTTGAGTACCTCTTTGAGCAGGGCAAGCATGAGTTT
GTGAATGACGTGGCATCACTGTGGGAGCTGTCGACCGAGGAGGAGATCCACCACTTTAAG
AATGAGAGCCTGGGCATGGCCTTTCTGCACCTCTGTCACCTCGCTCTCCGCCATGGCATC
CCCCTGGAGGAGGTGGCCAAGAAGACCAGCTTCAAGGACTGCATCCCGCGCTCCTTCCGC
CGGCATATCCGGCAGCACAGCGCCCTGACCCGGCTGCGCCTTCGGAACGTCTTCCGCAGG
TTCCTGCGGGACTTCCAGCCGGGCCGACTCTCCCAGCAGATGGTCATGGTCAAATACCTA
GCCACACTCGAGCGGCTGGCACCCCGCTTCGGCACAGAGCGTGTGCCCGTGTGCCACCTG
AGGCTGCTGGCCCAGGCCGAGGGGGAGCCCTGCTACATCCGGGACAGTGGGGTGGCCCCT
ACAGACCCTGGCCCTGAGTCTGCTGCTGGGCCCCCAACCCACGAGGTGCTGGTGACAGGC
ACTGGTGGCATCCAGTGGTGGCCAGTAGAGGAGGAGGTGAACAAGGAGGAGGGTTCTAGT
GGCAGCAGTGGCAGGAACCCCCAAGCCAGCCTGTTTGGGAAGAAGGCCAAGGCTCACAAG
GCATTCGGCCAGCCGGCAGACAGGCCGCGGGAGCCACTGTGGGCCTACTTCTGTGACTTC
CGGGACATCACCCACGTGGTGCTGAAAGAGCACTGTGTCAGCATCCACCGGCAGGACAAC
AAGTGCCTGGAGCTGAGCTTGCCTTCCCGGGCTGCGGCGCTGTCCTTCGTGTCGCTGGTG
GACGGCTATTTCCGCCTGACGGCCGACTCCAGCCACTACCTGTGCCACGAGGTGGCTCCC
CCACGGCTGGTGATGAGCATCCGGGATGGGATCCACGGACCCCTGCTGGAGCCATTTGTG
CAGGCCAAGCTGCGGCCCGAGGACGGCCTGTACCTCATTCACTGGAGCACCAGCCACCCC
TACCGCCTGATCCTCACAGTGGCCCAGCGTAGCCAGGCACCAGACGGCATGCAGAGCTTG
CGGCTCCGAAAGTTCCCCATTGAGCAGCAGGACGGGGCCTTCGTGCTGGAGGGCTGGGGC
CGGTCCTTCCCCAGCGTTCGGGAACTTGGGGCTGCCTTGCAGGGCTGCTTGCTGAGGGCC
GGGGATGACTGCTTCTCTCTGCGTCGCTGTTGCCTGCCCCAACCAGGAGAAACCTCCAAT
CTCATCATCATGCGGGGGGCTCGGGCCAGCCCCAGGACACTCAACCTCAGCCAGCTCAGC
TTCCACCGGGTTGACCAGAAGGAGATCACCCAGCTGTCCCACTTGGGCCAGGGCACAAGG
ACCAACGTGTATGAGGGCCGCCTGCGAGTGGAGGGCAGCGGGGACCCTGAGGAGGGCAAG
ATGGATGACGAGGACCCCCTCGTGCCTGGCAGGGACCGTGGGCAGGAGCTACGAGTGGTG
CTCAAAGTGCTGGACCCTAGTCACCATGACATCGCCCTGGCCTTCTACGAGACAGCCAGC
CTCATGAGCCAGGTCTCCCACACGCACCTGGCCTTCGTGCATGGCGTCTGTGTGCGCGGC
CCTGAAAATATCATGGTGACAGAGTACGTGGAGCACGGACCCCTGGATGTGTGGCTGCGG
AGGGAGCGGGGCCATGTGCCCATGGCTTGGAAGATGGTGGTGGCCCAGCAGCTGGCCAGC
GCCCTCAGCTACCTGGAGAACAAGAACCTGGTTCATGGTAATGTGTGTGGCCGGAACATC
CTGCTGGCCCGGCTGGGGTTGGCAGAGGGCACCAGCCCCTTCATCAAGCTGAGTGATCCT
GGCGTGGGCCTGGGCGCCCTCTCCAGGGAGGAGCGGGTGGAGAGGATCCCCTGGCTGGCC
CCCGAATGCCTACCAGGTGGGGCCAACAGCCTAAGCACCGCCATGGACAAGTGGGGGTTT
GGCGCCACCCTCCTGGAGATCTGCTTTGACGGAGAGGCCCCTCTGCAGAGCCGCAGTCCC
TCCGAGAAGGAGCATTTCTACCAGAGGCAGCACCGGCTGCCCGAGCCCTCCTGCCCACAG
CTGGCCACACTCACCAGCCAGTGTCTGACCTATGAGCCAACCCAGAGGCCATCATTCCGC
ACCATCCTGCGTGACCTCACCCGGCTGCAGCCCCACAATCTTGCTGACGTCTTGACTGTG
AACCCGGACTCACCGGCGTCGGACCCTACGGTTTTCCACAAGCGCTATTTGAAAAAGATC
CGAGATCTGGGCGAGGGTCACTTCGGCAAGGTCAGCTTGTACTGCTACGATCCGACCAAC
GACGGCACTGGCGAGATGGTGGCGGTGAAAGCCCTCAAGGCAGACTGCGGCCCCCAGCAC
CGCTCGGGCTGGAAGCAGGAGATTGACATTCTGCGCACGCTCTACCACGAGCACATCATC
AAGTACAAGGGCTGCTGCGAGGACCAAGGCGAGAAGTCGCTGCAGCTGGTCATGGAGTAC
GTGCCCCTGGGCAGCCTCCGAGACTACCTGCCCCGGCACAGCATCGGGCTGGCCCAGCTG
CTGCTCTTCGCCCAGCAGATCTGCGAGGGCATGGCCTATCTGCACGCGCAGCACTACATC
CACCGAGACCTAGCCGCGCGCAACGTGCTGCTGGACAACGACAGGCTGGTCAAGATCGGG
GACTTTGGCCTAGCCAAGGCCGTGCCCGAAGGCCACGAGTACTACCGCGTGCGCGAGGAT
GGGGACAGCCCCGTGTTCTGGTATGCCCCAGAGTGCCTGAAGGAGTATAAGTTCTACTAT
GCGTCAGATGTCTGGTCTTTCGGGGTGACCCTGTATGAGCTGCTGACGCACTGTGACTCC
AGCCAGAGCCCCCCCACGAAATTCCTTGAGCTCATAGGCATTGCTCAGGGTCAGATGACA
GTTCTGAGACTCACTGAGTTGCTGGAACGAGGGGAGAGGCTGCCACGGCCCGACAAATGT
CCCTGTGAGGTCTATCATCTCATGAAGAACTGCTGGGAGACAGAGGCGTCCTTTCGCCCA
ACCTTCGAGAACCTCATACCCATTCTGAAGACAGTCCATGAGAAGTACCAAGGCCAGGCC
CCTTCAGTGTTCAGCGTGTGCTGA

Clone variation with respect to NM_003331.4
1084 g=>t;3258 c=>t
5' Read Nucleotide Sequence
>OriGene 5' read for NM_003331 unedited
NTTATTACACCCGCCCGTTGNCGCAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATAT
AAGCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGC
CGCGAATTCGGCACGAGGCGAGCTTGTGTTCCCCCGGAAGGGTGAGTCTGGACGCGGGCG
CGGAAGGAGCGCGGCCGGAGGTCCTCAGGAAGAAGCCGCGGGGACTGGCTGCGCTTGACA
GGCTGCACTTGGATGGGAGCACCTGGTGCCTCGGGACTGCTCCGATGCCCGGGTCTGTGC
TGAATGTGTAATATGCGGAACTATATTGAAACATTACAACCATCTTTTGATGGCAACACC
CTGAGGACCTCCCTTTTCCAGATGGGGAAACTGAGGCCCAGAATTGCTAAGTGGCTTGCT
TGAGTTGACACAGGGAGCTCCAGGACTCACCCTCAGCTGAGCCACCTGCCGGGAGCATGC
CTCTGCGCCACTGGGGGATGGCCAGGGGCAGTAAGCCCGTTGGGGATGGAGCCCAGCCCA
TGGCTGCCATGGGAGGCCTGAAGGTGCTTCTGCACTGNGCTGGTCCAGGCGGCGGAGAGC
CCTGGGTCACTTTCAGTGAGTCATCGCTGACAGCTGANGAAGTCTGCATCCACATTGCAC
ATAAAGTTGGTATCACTCCTCCTTGCTTCGATCTCTCTGCCCTCTTCGATGCTCAGGCCC
AAGTCTGGTTGCCCCCANACCACATCCTAGAGATCCCCAGAGATGCCAGCCTGATGCTAT
ATTTCCGCATAAGGTTCTATTTTNCGGACTGGCATGGCATGAATCCCTCGGACCAGGCTG
TGTACCGNNTGTGGGCCCNCAGGAACCGAGCATCCTCAGATAGACGCACAGGTGATGCAA
CTTCTGGACCAGNCTCATTGAGTACCTCNTGAGCAGGCAGCATGAGC
Tag Tag Free
ACCN NM_003331
ORF Size 3564 bp
Insert Size 4200
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003331.3, NP_003322
RefSeq Size 4224
Locus ID 7297
Cytogenetics 19p13.2
Domains B41, pkinase, SH2, TyrKc, S_TKc
Protein Families Protein Kinase, Druggable Genome
Protein Pathways Jak-STAT signaling pathway
Gene Summary This gene encodes a member of the tyrosine kinase and, more specifically, the Janus kinases (JAKs) protein families. This protein associates with the cytoplasmic domain of type I and type II cytokine receptors and promulgate cytokine signals by phosphorylating receptor subunits. It is also component of both the type I and type III interferon signaling pathways. As such, it may play a role in anti-viral immunity. A mutation in this gene has been associated with hyperimmunoglobulin E syndrome (HIES) - a primary immunodeficiency characterized by elevated serum immunoglobulin E. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations