Integrin alpha 9 (ITGA9) (NM_002207) Human Untagged Clone

CAT#: SC127886

ITGA9 (untagged)-Human integrin, alpha 9 (ITGA9)


  "NM_002207" in other vectors (6)

Reconstitution Protocol

USD 902.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


ITGA9 Antibody - C-terminal region
    • 100 ul

USD 539.00

Other products for "Integrin alpha 9"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Integrin alpha 9
Synonyms ALPHA-RLC; ITGA4L; RLC
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC127886 sequence for NM_002207 edited (data generated by NextGen Sequencing)
ATGGGCGGCCCGGCTGCGCCGAGGGGCGCCGGGAGGCTCCGCGCGCTGCTGCTGGCGCTG
GTGGTCGCGGGGATCCCCGCGGGCGCCTACAACCTCGACCCGCAGCGCCCCGTGCACTTC
CAGGGCCCCGCTGACTCGTTCTTCGGCTACGCAGTTCTGGAGCATTTCCACGACAACACG
CGCTGGGTCCTTGTGGGCGCACCAAAGGCAGATTCCAAATACAGCCCTTCAGTGAAGTCT
CCTGGGGCTGTGTTTAAGTGCCGTGTTCACACCAACCCTGACCGGAGATGCACCGAACTG
GACATGGCTCGAGGGAAGAATCGGGGCACGTCCTGCGGAAAGACCTGCCGGGAAGACCGC
GATGATGAGTGGATGGGGGTGAGCCTGGCCCGACAGCCCAAGGCTGATGGCCGTGTGTTG
GCCTGTGCTCATCGCTGGAAGAACATCTACTATGAAGCCGACCACATCCTACCCCATGGC
TTCTGCTACATCATCCCCTCCAACCTCCAGGCCAAAGGCAGGACGCTGATCCCTTGCTAT
GAAGAGTATAAGAAGAAGTACGGAGAGGAACACGGCTCCTGCCAGGCTGGGATAGCGGGC
TTCTTCACCGAGGAGCTGGTGGTGATGGGTGCTCCAGGGTCATTTTATTGGGCTGGAACC
ATCAAAGTGCTGAACCTTACGGACAACACCTATTTAAAACTGAACGACGAAGTGATCATG
AACAGGCGGTACACCTACCTGGGCTACGCAGTGACCGCTGGCCACTTCTCTCACCCGTCC
ACCATTGATGTGGTAGGAGGTGCCCCACAGGACAAAGGCATCGGCAAGGTTTATATTTTC
AGAGCTGACCGAAGATCAGGCACCTTAATTAAGATCTTTCAAGCATCAGGTAAAAAGATG
GGCTCTTACTTCGGCTCCTCCTTGTGCGCAGTTGACCTGAATGGGGACGGCCTCTCTGAC
CTGCTGGTGGGGGCCCCCATGTTTTCTGAGATCAGGGATGAGGGACAGGTCACTGTCTAC
ATCAACAGAGGAAATGGAGCCCTCGAGGAGCAGCTGGCTCTGACTGGGGATGGTGCCTAC
AATGCGCACTTTGGAGAGAGCATTGCCAGCCTGGACGATCTGGACAATGATGGGTTCCCA
GATGTGGCCATTGGTGCACCCAAGGAGGATGACTTCGCAGGGGCGGTCTATATCTATCAT
GGTGATGCCAGTGGGATAGTCCCTCAGTACTCAATGAAACTGTCTGGGCAGAAGATAAAT
CCAGTGCTCCGGATGTTTGGTCAGTCCATATCGGGAGGCATTGATATGGATGGAAATGGC
TATCCTGATGTCACTGTTGGAGCCTTCATGTCCGACAGCGTGGTTCTTCTCAGAGCAAGG
CCTGTCATTACGGTGGATGTCTCCATCTTCCTCCCGGGCTCCATCAACATCACAGCGCCT
CAGTGTCACGACGGACAGCAGCCTGTGAACTGCCTGAACGTCACCACCTGCTTCAGCTTC
CATGGCAAACACGTTCCAGGAGAGATTGGCCTGAATTATGTTCTGATGGCTGACGTGGCC
AAAAAGGAGAAGGGCCAGATGCCCAGGGTCTACTTTGTGCTGCTGGGAGAGACCATGGGT
CAGGTCACAGAGAAGCTGCAGCTGACTTACATGGAGGAGACGTGTCGTCACTATGTGGCC
CATGTGAAGCGGAGGGTGCAGGACGTCATCAGCCCGATCGTGTTTGAAGCAGCCTACAGC
CTCAGTGAGCATGTGACTGGAGAGGAGGAGAGGGAACTGCCGCCTCTGACACCAGTTCTC
CGCTGGAAAAAGGGACAAAAGATTGCCCAAAAGAATCAGACTGTTTTTGAAAGGAATTGC
CGTTCAGAGGACTGTGCCGCAGACCTGCAGCTTCAGGGTAAACTGCTGCTCTCCAGTATG
GATGAGAAAACCCTGTATCTAGCTTTGGGGGCTGTGAAGAACATCTCCCTAAACATCTCT
ATCTCCAACCTCGGAGATGATGCCTATGATGCCAACGTGTCCTTCAATGTTTCCCGGGAG
CTCTTCTTCATCAACATGTGGCAGAAGGAGGAGATGGGCATCTCCTGTGAGCTGCTGGAA
TCGGACTTCCTCAAATGCAGCGTGGGATTTCCTTTCATGAGGTCAAAGTCAAAGTATGAA
TTCAGCGTGATCTTTGATACAAGCCACCTGTCTGGGGAAGAGGAAGTTCTCAGCTTCATT
GTTACTGCTCAGAGTGGCAACACGGAGCGCTCTGAATCCCTGCATGACAACACCCTCGTG
CTGATGGTGCCACTGATGCACGAGGTGGACACGTCCATCACCGGAATCATGTCTCCAACC
TCCTTTGTATATGGCGAGTCCGTGGACGCAGCCAACTTCATTCAGCTGGATGACCTGGAG
TGTCACTTTCAGCCCATCAATATCACCCTTCAGGTCTACAACACTGGCCCAAGCACCCTT
CCAGGGTCATCTGTCAGCATCTCTTTCCCTAATCGACTCTCATCTGGTGGTGCAGAGATG
TTTCATGTCCAGGAAATGGTGGTGGGCCAAGAGAAGGGAAACTGCTCTTTCCAGAAAAAC
CCAACTCCCTGCATCATCCCTCAAGAACAAGAAAATATCTTCCACACAATATTTGCTTTT
TTCACAAAGTCTGGAAGAAAAGTCTTGGACTGTGAAAAACCAGGAATTTCTTGCCTAACA
GCACACTGTAACTTTAGTGCTCTTGCTAAAGAAGAAAGTCGTACTATAGACATTTACATG
CTGCTGAACACAGAAATACTGAAAAAGGACAGTTCGTCTGTCATCCAGTTCATGTCCCGC
GCCAAGGTGAAGGTGGATCCTGCCCTAAGGGTGGTGGAAATAGCTCATGGGAACCCAGAA
GAGGTGACGGTGGTCTTCGAGGCCCTGCACAATCTGGAGCCCCGTGGCTACGTCGTGGGG
TGGATCATCGCCATCAGTTTGTTGGTGGGAATCCTCATCTTCCTGCTGCTGGCCGTGCTG
CTCTGGAAGATGGGCTTCTTTCGCCGAAGGTACAAAGAAATTATCGAAGCTGAGAAGAAC
CGGAAAGAGAATGAAGACAGTTGGGACTGGGTCCAGAAAAACCAGTGA

Clone variation with respect to NM_002207.2
1210 g=>a
>OriGene 5' read for NM_002207 unedited
ACTGACTATAGGGCGGCCGCGAATTCGGCACGAGCGGCGGCCGGCTGGGGATGGGCGGCC
CGGCTGCGCCGAGGGGCGCCGGGAGGCTCCGCGCGCTGCTGCTGGCGCTGGTGGTCGCGG
GGATCCCCGCGGGCGCCTACAACCTCGACCCGCAGCGCCCCGTGCACTTCCAGGGCCCCG
CTGACTCGTTCTTCGGCTACGCAGTTCTGGAGCATTTCCACGACAACACGCGCTGGGTCC
TTGTGGGCGCACCAAAGGCAGATTCCAAATACAGCCCTTCAGTGAAGTCTCCTGGGGCTG
TGTTTAAGTGCCGTGTTCACACCAACCCTGACCGGAGATGCACCGAACTGGACATGGCTC
GAGGGAAGAATCGGGGCACGTCCTGCGGAAAGACCTGCCGGGAAGACCGCGATGATGAGT
GGATGGGGGTGAGCCTGGCCCGACAGCCCAAGGCTGATGGCCGTGTGTTGGCCTGTGCTC
ATCGCTGGAAGAACATCTACTATGAAGCCGACCACATCCTACCCCATGGCTTCTGCTACA
TCATCCCCTCCAACCTCCAGGCCAAAGGCAGGACGCTGATCCCTTGCTATGAAGAGTATA
AGAAGAAGTACGGAGAGGAACACGGCTCCTGCCAGGCTGGGATAGCGGGCTTCTTCACCG
AGGAGCTGGTGGTGATGGGTGCTCCAGGGTCATTTTATTGGGCTGGAACCATCAAAGTGC
TGAACCTTACGGACAACACC
>OriGene 3' read for NM_002207 unedited
CGCGCCAGGAGAGGCACTGGGGAGGGGTCACAGGGATGCCACCCGGGATCTGTTCAGGAA
ACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCCCTTAAAAAAAACCGGGGT
TTTTTTTCCCAGGGTTTTTTTTGGCCCCTTCCTGGGCCGGGTCCCCCCCCTTTTTTAGGG
GTTTCCCCGGGGAAACCCCCCTTAAAAATTTACTTGCCCCCAAATCCTTGTTTCGGGGGC
GGTTTTTGGGGACCCCAATCTAAAACTTTTTTTTTAAAACGGTTAAATGCCCCCTCGGGG
AAGGAATCTGCAATCCCCCCTTGTGGGGACACCCGGGGGGGGGGGGGAAAAAAAATTCCC
CCAGGGAAAATTCCCCCAAAAGGGGGTTCCCCCCCAGTTTTTAACCCCATTTTTTTGTTT
AGGGGACAAGGATTTACCCCTGGGGGGGGGGGAACCCGGAGCCCGGGTGCCCAGGATGAA
CCCCCCTTTTGGGGTTTCCCAAATGACCCCTGGGGTTTGCCCCAAGCTTTCATCCATCAT
TTGTGTAAAACCCGGGGGACCTGTTTGCTTTTAAAAGGGGATCCCAAGCAAACTTCTTGC
GGGGGATCAGGTTTTCCACCCAAATTCTGGTTGGGAACCTTCCCGTGGAAGGTCCTTTTG
AAAAAACCCTTACATTTCTT
Restriction Sites Please inquire     
ACCN NM_002207
Insert Size 4700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002207.2, NP_002198.2
RefSeq Size 3962 bp
RefSeq ORF 3108 bp
Locus ID 3680
UniProt ID Q13797
Cytogenetics 3p22.2
Domains FG-GAP
Protein Families Druggable Genome, Transmembrane
Protein Pathways Arrhythmogenic right ventricular cardiomyopathy (ARVC), Cell adhesion molecules (CAMs), Dilated cardiomyopathy, ECM-receptor interaction, Focal adhesion, Hypertrophic cardiomyopathy (HCM), Regulation of actin cytoskeleton
Gene Summary This gene encodes an alpha integrin. Integrins are heterodimeric integral membrane glycoproteins composed of an alpha chain and a beta chain that mediate cell-cell and cell-matrix adhesion. The protein encoded by this gene, when bound to the beta 1 chain, forms an integrin that is a receptor for VCAM1, cytotactin and osteopontin. Expression of this gene has been found to be upregulated in small cell lung cancers. [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.