Aromatase(CYP19A1) (NM_000103) Human Untagged Clone

CAT#: SC127848

CYP19A1 (untagged)-Human cytochrome P450, family 19, subfamily A, polypeptide 1 (CYP19A1), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Aromatase(CYP19A1) (NM_000103) Human Untagged Clone
Symbol CYP19A1
Synonyms ARO; ARO1; CPV1; CYAR; CYP19; CYPXIX; P-450AROM
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC127848 sequence for NM_000103 edited (data generated by NextGen Sequencing)
ATGGTTTTGGAAATGCTGAACCCGATACATTATAACATCACCAGCATCGTGCCTGAAGCC
ATGCCTGCTGCCACCATGCCAGTCCTGCTCCTCACTGGCCTTTTTCTCTTGGTGTGGAAT
TATGAGGGCACATCCTCAATACCAGGTCCTGGCTACTGCATGGGAATTGGACCCCTCATC
TCCCACGGCAGATTCCTGTGGATGGGGATCGGCAGTGCCTGCAACTACTACAACCGGGTA
TATGGAGAATTCATGCGAGTCTGGATCTCTGGAGAGGAAACACTCATTATCAGCAAGTCC
TCAAGTATGTTCCACATAATGAAGCACAATCATTACAGCTCTCGATTCGGCAGCAAACTT
GGGCTGCAGTGCATCGGTATGCATGAGAAAGGCATCATATTTAACAACAATCCAGAGCTC
TGGAAAACAACTCGACCCTTCTTTATGAAAGCTCTGTCAGGCCCCGGCCTTGTTCGTATG
GTCACAGTCTGTGCTGAATCCCTCAAAACACATCTGGACAGGTTGGAGGAGGTGACCAAT
GAATCGGGCTATGTGGACGTGTTGACCCTTCTGCGTCGTGTCATGCTGGACACCTCTAAC
ACGCTCTTCTTGAGGATCCCTTTGGACGAAAGTGCTATCGTGGTTAAAATCCAAGGTTAT
TTTGATGCATGGCAAGCTCTCCTCATCAAACCAGACATCTTCTTTAAGATTTCTTGGCTA
TACAAAAAGTATGAGAAGTCTGTCAAGGATTTGAAAGATGCCATAGAAGTTCTGATAGCA
GAAAAAAGACGCAGGATTTCCACAGAAGAGAAACTGGAAGAATGTATGGACTTTGCCACT
GAGTTGATTTTAGCAGAGAAACGTGGTGACCTGACAAGAGAGAATGTGAACCAGTGCATA
TTGGAAATGCTGATCGCAGCTCCTGACACCATGTCTGTCTCTTTGTTCTTCATGCTATTT
CTCATTGCAAAGCACCCTAATGTTGAAGAGGCAATAATAAAGGAAATCCAGACTGTTATT
GGTGAGAGAGACATAAAGATTGATGATATACAAAAATTAAAAGTGATGGAAAACTTCATT
TATGAGAGCATGCGGTACCAGCCTGTCGTGGACTTGGTCATGCGCAAAGCCTTAGAAGAT
GATGTAATCGATGGCTACCCAGTGAAAAAGGGGACAAACATTATCCTGAATATTGGAAGG
ATGCACAGACTCGAGTTTTTCCCCAAACCCAATGAATTTACTCTTGAAAATTTTGCAAAG
AATGTTCCTTATAGGTACTTTCAGCCATTTGGCTTTGGGCCCCGTGGCTGTGCAGGAAAG
TACATCGCCATGGTGATGATGAAAGCCATCCTCGTTACACTTCTGAGACGATTCCACGTG
AAGACATTGCAAGGACAGTGTGTTGAGAGCATACAGAAGATACACGACTTGTCCTTGCAC
CCAGATGAGACTAAAAACATGCTGGAAATGATCTTTACCCCAAGAAACTCAGACAGGTGT
CTGGAACACTAG

Clone variation with respect to NM_000103.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000103 unedited
AGTTCACAATTGTATACGACNACTATAGGCGGCCGCGNAATTCGCACCAGGGCAAACAGG
AAGGTGAAGAAGAACTTATCCTATCAGGACGGAAGGTCCTGTGCTCGGGATCTTCCAGAC
GTCGCGACTCTAAATTGCCCCCTCTGAGGTCAAGGAACACAAGATGGTTTTGGAAATGCT
GAACCCGATACATTATAACATCACCAGCATCGTGCCTGAAGCCATGCCTGCTGCCACCAT
GCCAGTCCTGCTCCTCACTGGCCTTTTTCTCTTGGTGTGGAATTATGAGGGCACATCCTC
AATACCAGGTCCTGGCTACTGCATGGGAATTGGACCCCTCATCTCCCACGGCAGATTCCT
GTGGATGGGGATCGGCAGTGCCTGCAACTACTACAACCGGGTATATGGAGAATTCATGCG
AGTCTGGATCTCTGGAGAGGAAACACTCATTATCAGCAAGTCCTCAAGTATGTTCCACAT
AATGAAGCACAATCATTACAGCTCTCGATTCGGCAGCAAACTTGGGCTGCAGTGCATCGG
TATGCATGAGATAGGCATCATATTTAACAACAATCCAGAGCTCTGGAAAACAACTCGACC
CTTCTTTATGAAAGCTCTGTCAGGCCCCGGCCTTGTTCGTATGGTCACAGTCTGTGCTGA
ATCCCTCANAACACATCTGGACAGGTTGGAGGATGTGACCAATGAATCGGGCTTGTGGNA
CGTGTTGACCCTTCTGCGTCGTGTCATGCTGGACACCTCTACACGCTCTTCTTGANGATC
CCTTTGGACGAAGTGCTATCGTGGNTAAATNCAAGGTATTNTGATGCATGGCAGCTCTCT
CATCAACAGAATCTCTTTAGATTTCTGCTTACAAAGTTGANAAGCGTCAAGATTGAAGAT
CCCTAAAGTCTGATACGAAAAGAGCAGATTNCCGAAAGACTGGANATGATGACTTGNCCT
GGATGTTTACNAAAACTGTGACGA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000103 unedited
CGTTTCTTTTCCCCCCCCCCCCAATGCTGGGGAGAAGAGCCAATTGTGAGTGTTTGAATG
ACATTCAGTAGAGATAGTTATATTGGCTATATTACACAAGTAAAGTGGTGTTTGGAAAGT
TCCTACATTCATTTGATTTCCTTTAGAAAGCGAATTCCAAGGTGTGCAATTTATCCATGA
CCACTTACATTGATTCATGGAACCAAAATATGTTAGATTCCCTCAGGTAACCGGTTAAAA
TTTTGAGGTTGGAGTTAAAAAAATACTTCAGGGGGGTTTTACTTTTGGACCACCGTTTTT
TTATTGGAGTGGGGGCCCCCTAGGATCTTTGGGGGCAGGGCGAAAAAAAAAGGGGGAAAA
TATTTTCCGGGGGGAAAGAATAATAGGGGGTTAAAAGAGAGAGGCCCCCTCTTAAGAGAG
TGGACACCCCCCTGGGGGGGGGGGATTTTTTTTTTCCCCAACAAACCAATCCCCTTGTTA
TAAAGAAAACACCAAAATGGGGGCAGAAAACACGCCGGTTCCTTCTGGTGTGGCGCCCCC
CCTCTTATTTTGGCACAACACAAAAAAGGGGGAGCACACCCCCCCCAGAGCTTCTTTTTT
TTATTTATCTTAAAGAGGGCGCGCGGCGCGAAGATGTCTTTCCTTTCCTAAAAAAGAAAG
AGGGCCGGCGCCAATATTAATCCCCCCCCCCCCTCTCTTAAATATATTTTTTGCCCCCGT
GGGGGATAATATTAAAATTTGTTTCTCCCCCCATCCACACCAGCCACACCACACAAAATA
TTGTCTCANTGTCGCCTCGGGCCGTGCGGCGCGTCTACGACCAACACCGGCGGCGGAGAA
AACACTTCTGCCTCAATAAATTTCTCCCCCCCCCCCCCACATTTATTGTTCCACAAAACA
AAAAGGTTTGTTTTCTTTTTTTTTAAATCGGCGCCAAGACCCGAACGTNTTTTACCACCT
CCTAAACCACCATAAAGATCTTTTTTCGTTCCCCCCCCCCCCCCACACAAAAAAAAATTG
TTCCTTCTCTCTCCCG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000103
ORF Size 1512 bp
Insert Size 3050
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000103.2, NP_000094
RefSeq Size 3007
RefSeq ORF 1512
Locus ID 1588
Cytogenetics 15q21.2
Domains p450
Protein Families P450, Druggable Genome
Protein Pathways Androgen and estrogen metabolism, Metabolic pathways
Gene Summary Catalyzes the formation of aromatic C18 estrogens from C19 androgens. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) does not include exon 2a, and thus has a shorter 5' UTR than transcript variant 2. Both variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (4)