Fatty Acid Synthase(FASN) (NM_004104) Human Untagged Clone

CAT#: SC127829

FASN (untagged)-Human fatty acid synthase (FASN)

USD 2,658


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Fatty Acid Synthase(FASN) (NM_004104) Human Untagged Clone
Symbol FASN
Synonyms FAS; OA-519; SDR27X1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC127829 sequence for NM_004104 edited (data generated by NextGen Sequencing)
ATGGAGGAGGTGGTGATTGCCGGCATGTCCGGGAAGCTGCCAGAGTCGGAGAACTTGCAG
GAGTTCTGGGACAACCTCATCGGCGGTGTGGACATGGTCACGGACGATGACCGTCGCTGG
AAGGCGGGGCTCTACGGCCTGCCCCGGCGGTCCGGCAAGCTGAAGGACCTGTCTAGGTTT
GATGCCTCCTTCTTCGGAGTCCACCCCAAGCAGGCACACACGATGGACCCTCAGCTGCGG
CTGCTGCTGGAAGTCACCTATGAAGCCATCGTGGACGGAGGCATCAACCCAGATTCACTC
CGAGGAACACACACTGGCGTCTGGGTGGGCGTGAGCGGCTCTGAGACCTCGGAGGCCCTG
AGCCGAGACCCCGAGACACTCGTGGGCTACAGCATGGTGGGCTGCCAGCGAGCGATGATG
GCCAACCGGCTCTCCTTCTTCTTCGACTTCAGAGGGCCCAGCATCGCACTGGACACAGCC
TGCTCCTCCAGCCTGATGGCCCTGCAGAACGCCTACCAGGCCATCCACAGCGGGCAGTGC
CCTGCCGCCATCGTGGGGGGCATCAATGTCCTGCTGAAGCCCAACACCTCCGTGCAGTTC
TTGAGGCTGGGGATGCTCAGCCCCGAGGGCACCTGCAAGGCCTTCGACACAGCGGGGAAT
GGGTACTGCCGCTCGGAGGGTGTGGTGGCCGTCCTGCTGACCAAGAAGTCCCTGGCCCGG
CGGGTGTACGCCACCATCCTGAACGCCGGCACCAATACAGATGGCTTCAAGGAGCAAGGC
GTGACCTTCCCCTCAGGGGATATCCAGGAGCAGCTCATCCGCTCGTTGTACCAGTCGGCC
GGAGTGGCCCCTGAGTCATTTGAATACATCGAAGCCCACGGCACAGGCACCAAGGTGGGC
GACCCCCAGGAGCTGAATGGCATCACCCGAGCCCTGTGCGCCACCCGCCAGGAGCCGCTG
CTCATCGGCTCCACCAAGTCCAACATGGGGCACCCGGAGCCAGCCTCGGGGCTGGCAGCC
CTGGCCAAGGTGCTGCTGTCCCTGGAGCACGGGCTCTGGGCCCCCAACCTGCACTTCCAT
AGCCCCAACCCTGAGATCCCAGCGCTGTTGGATGGGCGGCTGCAGGTGGTGGACCAGCCC
CTGCCCGTCCGTGGCGGCAACGTGGGCATCAACTCCTTTGGCTTCGGGGGCTCCAACGTG
CACATCATCCTGAGGCCCAACACGCAGCCGCCCCCCGCACCCGCCCCACATGCCACCCTG
CCCCGTCTGCTGCGGGCCAGCGGACGCACCCCTGAGGCCGTGCAGAAGCTGCTGGAGCAG
GGCCTCCGGCACAGCCAGGACCTGGCTTTCCTGAGCATGCTGAACGACATCGCGGCTGTC
CCCGCCACCGCCATGCCCTTCCGTGGCTACGCTGTGCTGGGTGGTGAGCGCGGTGGCCCA
GAGGTGCAGCAGGTGCCCGCTGGCGAGCGCCCGCTCTGGTTCATCTGCTCTGGGATGGGC
ACACAGTGGCGCGGGATGGGGCTGAGCCTCATGCGCCTGGACCGCTTCCGAGATTCCATC
CTACGCTCCGATGAGGCTGTGAAGCCATTCGGCCTGAAGGTGTCACAGCTGCTGCTGAGC
ACAGACGAGAGCACCTTTGATGACATCGTCCATTCGTTTGTGAGCCTGACTGCCATCCAG
ATAGGCCTCATAGACCTGCTGAGCTGCATGGGGCTGAGGCCAGATGGCATCGTCGGCCAC
TCCCTGGGGGAGGTGGCCTGTGGCTACGCCGACGGCTGCCTGTCCCAGGAGGAGGCCGTC
CTCGCTGCCTACTGGAGGGGACAGTGCATCAAAGAAGCCCATCTCCCGCCGGGCGCCATG
GCAGCCGTGGGCTTGTCCTGGGAGGAGTGTAAACAGCGCTGCCCCCCGGGCGTGGTGCCC
GCCTGCCACAACTCCAAGGACACAGTCACCATCTCGGGACCTCAGGCCCCGGTGTTTGAG
TTCGTGGAGCAGCTGAGGAAGGAGGGTGTGTTTGCCAAGGAGGTGCGGACCGGCGGTATG
GCCTTCCACTCCTACTTCATGGAGGCCATCGCACCCCCACTGCTGCAGGAGCTCAAGAAG
GTGATCCGGGAGCCGAAGCCACGTTCAGCCCGCTGGCTCAGCACCTCTATCCCCGAGGCC
CAGTGGCACAGCAGCCTGGCACGCACGTCCTCCGCCGAGTACAATGTCAACAACCTGGTG
AGCCCTGTGCTGTTCCAGGAGGCCCTGTGGCACGTGCCTGAGCACGCGGTGGTGCTGGAG
ATCGCGCCCCACGCCCTGCTGCAGGCTGTCCTGAAGCGTGGCCTGAAGCCGAGCTGCACC
ATCATCCCCCTGATGAAGAAGGATCACAGGGACAACCTGGAGTTCTTCCTGGCCGGCATC
GGCAGGCTGCACCTCTCAGGCATCGACGCCAACCCCAATGCCTTGTTCCCACCTGTGGAG
TTCCCAGCTCCCCGAGGAACTCCCCTCATCTCCCCACTCATCAAGTGGGACCACAGCCTG
GNNNNGGACGTGCCGGCCGCCGAGGACTTCCCCAACGGTTCAGGTTCCCCCTCAGCCGCC
ATCTACAACATCGACACCAGCTCCGAGTCTCCTGACCACTACCTGGTGGACCACACCCTC
GACGGTCNNNNNNNNNNCCCCGCCACTGGCTACCTGAGCATAGTGTGGAAGACGCTGGCC
CGCGCCCTGGGCCTGGGCGTCGAGCAGCTGCCTGTGGTGTTTGAGGATGTGGTGCTGCAC
CAGGCCACCATCCTGCCCAAGACTGGGACAGTGTCCCTGGAGGTACGGCTCCTGGAGGCC
TCCCGTGCCTTCGAGGTGTCAGAGAACGGCAACCTGGTAGTGAGTGGGAAGGTGTACCAG
TGGGATGACCCTGACCCCAGGCTCTTCGACCACCCGGAAAGCCCCACCCCCAACCCCACG
GAGCCCCTCTTCCTGGCCCAGGCTGAAGTTTACAAGGAGCTGCGTCTGCGTGGCTACGAC
TACGGCCCTCATTTCCAGGGCATCCTGGAGGCCAGCCTGGAAGGTGACTCGGGGAGGCTG
CTGTGGAAGGATAACTGGGTGAGCTTCATGGACACCATGCTGCAGATGTCCATCCTGGGC
TCGGCCAAGCACGGCCTGTACCTGCCCACCCGTGTCACCGCCATCCACATCGACCCTGCC
ACCCACAGGCAGAAGCTGTACACACTGCAGGACAAGGCCCAAGTGGCTGACGTGGTGGTG
AGCAGGTGGCTGAGGGTCACAGTGGCCGGAGGCGTCCACATCTCCGGGCTCCACACTGAG
TCGGCCCCGCGGCGGCAGCAGGAGCAGCAGGTGCCCATCCTGGAGAAGTTTTGCTTCACT
CCCCACACGGAGGAGGGGTGCCTGTCTGAGCGCGCTGCCCTGCAGGAGGAGCTGCAACTG
TGCAAGGGGCTGGTGCAGGCACTGCAGACCACGGTGACCCAGCAGGGGCTGAAGATGGTG
GTGCCCGGACTGGATGGGGCCCAGATCCCCCGGGACCCCTCACAGCAGGAACTGCCCCGG
CTGTTGTCGGCTGCCTGCAGGCTTCAGCTCAACGGGAACCTGCAGCTGGAGCTGGCGCAG
GTGCTGGCCCAGGAGAGGCCCAAGCTGCCAGAGGACCCTCTGCTCAGCGGCCTCCTGGAC
TCCCCGGCACTCAAGGCCTGCCTGGACACTGCCGTGGAGAACATGCCCAGCCTGAAGATG
AAGGTGGTGGAGGTGCTGGCTGGCCACGGTCACCTGTATTCCCGCATCCCAGGCCTGCTC
AGCCCCCATCCCCTGCTGCAGCTGAGCTACACGGCCACCGACCGCCACCCCCAGGCCCTG
GAGGCTGCCCAGGCCGAGCTGCAGCAGCACGACGTTGCCCAGGGCCAGTGGGATCCCGCA
GACCCTGCCCCCAGCGCCCTGGGCAGCGCCGACCTCCTGGTGTGCAACTGTGCTGTGGCT
GCCCTCGGGGACCCGGCCTCAGCTCTCAGCAACATGGTGGCTGCCCTGAGAGAAGGGGGC
TTTCTGCTCCTGCACACACTGCTCCGGGGGCACCCCCTCGGGGACATCGTGGCCTTCCTC
ACCTCCACTGAGCCGCAGTATGGCCAGGGCATCCTGAGCCAGGACGCGTGGGAGAGCCTC
TTCTCCAGGGTGTCGCTGCGCCTGGTGGGCCTGAAGAAGTCCTTCTACGGCTCCACGCTC
TTCCTGTGCCGCCGGCCCACCCCGCAGGACAGCCCCATCTTCCTGCCGGTGGACGATACC
AGCTTCCGCTGGGTGGAGTCTCTGAAGGGCATCCTGGCTGACGAAGACTCTTCCCGGCCT
GTGTGGCTGAAGGCCATCAACTGTGCCACCTCGGGCGTGGTGGGCTTGGTGAACTGTCTC
CGCCGAGAGCCCGGCGGGAACCGCCTCCGGTGTGTGCTGCTCTCCAACCTCAGCAGCACC
TCCCACGTCCCGGAGGTGGACCCGGGCTCCGCAGAACTGCAGAAGGTGTTGCAGGGAGAC
CTGGTGATGAACGTCTACCGCGACGGGGCCTGGGGGGCTTTCCGCCACTTCCTGCTGGAG
GAGGACAAGCCTGAGGAGCCGACGGCACATGCCTTTGTGAGCACCCTCACCCGGGGGGAC
CTGTCCTCCATCCGCTGGGTCTGCTCCTCGCTGCGCCATGCCCAGCCCACCTGCCCTGGC
GCCCAGCTCTGCACGGTCTACTACGCCTCCCTCAACTTCCGCGACATCATGCTGGCCACT
GGCAAGCTGTCCCCTGATGCCATCCCAGGGAAGTGGACCTCCCAGGACAGCCTGCTAGGT
ATGGAGTTCTCGGGCCGAGACGCCAGCGGCAAGCGTGTGATGGGACTGGTGCCTGCCAAG
GGCCTGGCCACCTCTGTCCTGCTGTCACCGGACTTCCTCTGGGATGTGCCTTCCAACTGG
ACGCTGGAGGAGGCGGCCTCGGTGCCTGTCGTCTACAGCACGGCCTACTACGCGCTGGTG
GTGCGTGGGCGGGTGCGCCCCGGGGAGACGCTGCTCATCCACTCGGGCTCGGGCGGCGTG
GGCCAGGCCGCCATCGCCATCGCCCTCAGTCTGGGCTGCCGCGTCTTCACCACCGTGGGG
TCGGCTGAGAAGCGGGCGTACCTCCAGGCCAGGTTCCCCCAGCTCGACAGCACCAGCTTC
GCCAACTCCCGGGACACATCCTTCGAGCAGCATGTGCTGTGGCACACGGGCGGGAAGGGC
GTTGACCTGGTCTTGAACTCCTTGGCGGAAGAGAAGCTGCAGGCCAGCGTGAGGTGCTTG
GCTACGCACGGTCGCTTCCTGGAAATTGGCAAATTCGACCTTTCTCAGAACCACCCGCTC
GGCATGGCTATCTTCCTGAAGAACGTGACATTCCACGGGGTCCTACTGGATGCGTTCTTC
AACGAGAGCAGTGCTGACTGGCGGGAGGTGTGGGCGCTTGTGCAGGCCGGCATCCGGGAT
GGGGTGGTACGGCCCCTCAAGTGCACGGTGTTCCATGGGGCCCAGGTGGAGGACGCCTTC
CGCTACATGGCCCAAGGGAAGCACATTGGCAAAGTCGTCGTGCAGGTGCTTGCGGAGGAG
CCGGAGGCAGTGTTGAAGGGGGCCAAACCCAAGCTGATGTCGGCCATCTCCAAGACCTTC
TGCCCGGCCCACAAGAGCTACATCATCGCTGGTGGTCTGGGTGGCTTCGGCCTGGAGTTG
GCGCAGTGGCTGATACAGCGTGGGGTGCAGAAGCTCGTGTTGACTTCTCGCTCCGGGATC
CGGACAGGCTACCAGGCCAAGCAGGTCCGCCGGTGGAGGCGCCAGGGCGTACAGGTGCAG
GTGTCCACCAGCAACATCAGCTCACTGGAGGGGGCCCGGGGCCTCATTGCCGAGGCGGCG
CAGCTTGGGCCCGTGGGCGGCGTCTTCAACCTGGCCGTGGTCTTGAGAGATGGCTTGCTG
GAGAACCAGACCCCAGAGTTCTTCCAGGACGTCTGCAAGCCCAAGTACAGCGGCACCCTG
AACCTGGACAGGGTGACCCGAGAGGCGTGCCCTGAGCTGGACTACTTTGTGGTCTTCTCC
TCTGTGAGCTGCGGGCGTGGCAATGCGGGACAGAGCAACTACGGCTTTGCCAATTCCGCC
ATGGAGCGTATCTGTGAGAAACGCCGGCACGAAGGCCTCCCAGGCCTGGCCGTGCAGTGG
GGCGCCATCGGCGACGTGGGCATTTTGGTGGAGACGATGAGCACCAACGACACGATCGTC
AGTGGCACGCTGCCCCAGCGCATGGCGTCCTGCCTGGAGGTGCTGGACCTCTTCCTGAAC
CAGCCCCACATGGTCCTGAGCAGCTTTGTGCTGGCTGAGAAGGCTGCGGCCTATAGGGAC
AGGGACAGCCAGCGGGACCTGGTGGAGGCCGTGGCACACATCCTGGGCATCCGCGACTTG
GCTGCTGTCAACCTGGACAGCTCACTGGCGGACCTGGGCCTGGACTCGCTCATGAGCGTG
GAGGTGCGCCAGACGCTGGAGCGTGAGCTCAACCTGGTGCTGTCCGTGCGCGAGGTGCGG
CAACTCACGCTCCGGAAACTGCAGGAGCTGTCCTCAAAGGCGGATGAGGCCAGCGAGCTG
GCATGCCCCACGCCCAAGGAGGATGGTCTGGCCCAGCAGCAGACTCAGCTGAACCTGCGC
TCCCTGCTGGTGAACCCGGAGGGCCCCACCCTGATGCGGCTCAACTCCGTGCAGAGCTCG
GAGCGGCCCCTGTTCCTGGTGCACCCAATCGAGGGCTCCACCACCGTGTTCCACAGCCTG
GCCTCCCGGCTCAGCATCCCCACCTATGGCCTGCAGTGCACCCGAGCTGCGCCCCTTGAC
AGCATCCACAGCCTGGCTGCCTACTACATCGACTGCATCAGGCAGGTGCAGCCCGAGGGC
CCCTACCGCGTGGCCGGCTACTCCTACGGGGCCTGCGTGGCCTTTGAAATGTGCTCCCAG
CTGCAGGCCCAGCAGAGCCCAGCCCCCACCCACAACAGCCTCTTCCTGTTCGACGGCTCG
CCCACCTACGTACTGGCCTACACCCAGAGCTACCGGGCAAAGCTGACCCCAGGCTGTGAG
GCTGAGGCTGAGACGGAGGCCATATGCTTCTTCGTGCAGCAGTTCACGGACATGGAGCAC
AACAGGGTGCTGGAGGCGCTGCTGCCGCTGAAGGGCCTAGAGGAGCGTGTGGCAGCCGCC
GTGGACCTGATCATCAAGAGCCACCAGGGCCTGGACCGCCAGGAGCTGAGCTTTGCGGCC
CGGTCCTTCTACTACAAGCTGCGTGCCGCTGAGCAGTACACACCCAAGGCCAAGTACCAT
GGCAACGTGATGCTACTGCGCGCCAAGACGGGTGGCGCCTACGGCGAGGACCTGGGCGCG
GACTACAACCTCTCCCAGGTATGCGACGGGAAAGTATCCGTCCACGTCATCGAGGGTGAC
CACCGCACGCTGCTGGAGGGCAGCGGCCTGGAGTCCATCATCAGCATCATCCACAGCTCC
CTGGCTGAGCCACGCGTGAGCGTGCGGGAGGGCTAG

Clone variation with respect to NM_004104.4
2522 c=>n;2523 c=>n;2524 t=>n;2525 g=>n;2648 g=>n;2649 c=>n;2650 g=>n;2651 t=>n;2652 c=>n;2653 c=>n;2654 t=>n;2655 c=>n;2656 t=>n;2657 t=>n;3452 a=>c;5593 c=>t
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004104 unedited
CACGCACTATAGGGCGGCCGCGAATTCCCGGGATATCGTCGACCCACGCGTCCGGAGAGA
CGGCAGCGGCCCCGGCCTCCCTCTCCGCCGCGCTTCAGCCTCCCGCTCCGCCGCGCTCCA
GCCTCGCTCTCCGCCGCCCGCACCGCCGCCCGCGCCCTCACCAGAGCAGCCATGGAGGAG
GTGGTGATTGCCGGCATGTCCGGGAAGCTGCCAGAGTCGGAGAACTTGCAGGAGTTCTGG
GACAACCTCATCGGCGGTGTGGACATGGTCACGGACGATGACCGTCGCTGGAAGGCGGGG
CTCTACGGCCTGCCCCGGCGGTCCGGCAAGCTGAAGGACCTGTCTAGGTTTGATGCCTCC
TTCTTCGGAGTCCACCCCAAGCAGGCACACACGATGGACCCTCAGCTGCGGCTGCTGCTG
GAAGTCACCTATGAAGCCATCGTGGACGGAGGCATCAACCCAGATTCACTCCGAGGAACA
CACACTGGCGTCTGGGTGGGCGTGAGCGGCTCTGAGACCTCGGAGGCCCTGAGCCGAGAC
CCCGAGACACTCGTGGGCTACAGCATGGTGGGCTGCCAGCGAGCGATGATGGCCAACCGG
CTCTCCTTCTTCTTCGACTTCAGAGGGCCCAGCATCGCACTGGACACAGCCTGCTCCTCC
AGCCTGATGGCCCTGCAGAACGCCTACCAGGCCATCCACAGCGGGCAGTGCCCTGCCGCC
ATCGTGGGGGGCATCAATGTCCTGCTGAAN
Tag Tag Free
ACCN NM_004104
ORF Size 7536 bp
Insert Size 9000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_004104.4, NP_004095
RefSeq Size 8481
RefSeq ORF 7536
Locus ID 2194
Cytogenetics 17q25.3
Protein Families Druggable Genome
Protein Pathways Fatty acid biosynthesis, Metabolic pathways, Insulin signaling pathway
Gene Summary Fatty acid synthetase catalyzes the formation of long-chain fatty acids from acetyl-CoA, malonyl-CoA and NADPH. This multifunctional protein has 7 catalytic activities and an acyl carrier protein. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations