CDC25B (NM_021873) Human Untagged Clone

CAT#: SC126594

CDC25B (untagged)-Human cell division cycle 25 homolog B (S. pombe) (CDC25B), transcript variant 1

USD 721.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name CDC25B (NM_021873) Human Untagged Clone
Symbol CDC25B
Synonyms OTTHUMP00000030137; OTTHUMP00000030138; OTTHUMP00000030139; cell division cycle 25B; cell division cycle 25 homolog B (S. pombe)
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC126594 sequence for NM_021873 edited (data generated by NextGen Sequencing)
ATGGAGGTGCCCCAGCCGGAGCCCGCGCCAGGCTCGGCTCTCAGTCCAGCAGGCGTGTGC
GGTGGCGCCCAGCGTCCGGGCCACCTCCCGGGCCTCCTGCTGGGATCTCATGGCCTCCTG
GGGTCCCCGGTGCGGGCGGCCGCTTCCTCGCCGGTCACCACCCTCACCCAGACCATGCAC
GACCTCGCCGGGCTCGGCAGCGAAACCCCAAAGAGTCAGGTAGGGACCCTGCTCTTCCGC
AGCCGCAGCCGCCTGACGCACCTATCCCTGTCTCGACGGGCATCCGAATCCTCCCTGTCG
TCTGAATCCTCCGAATCTTCTGATGCAGGTCTCTGCATGGATTCCCCCAGCCCTATGGAC
CCCCACATGGCGGAGCAGACGTTTGAACAGGCCATCCAGGCAGCCAGCCGGATCATTCGA
AACGAGCAGTTTGCCATCAGACGCTTCCAGTCTATGCCGGTGAGGCTGCTGGGCCACAGC
CCCGTGCTTCGGAACATCACCAACTCCCAGGCGCCCGACGGCCGGAGGAAGAGCGAGGCG
GGCAGTGGAGCTGCCAGCAGCTCTGGGGAAGACAAGGAGAATGATGGATTTGTCTTCAAG
ATGCCATGGAAGCCCACACATCCCAGCTCCACCCATGCTCTGGCAGAGTGGGCCAGCCGC
AGGGAAGCCTTTGCCCAGAGACCCAGCTCGGCCCCCGACCTGATGTGTCTCAGTCCTGAC
CGGAAGATGGAAGTGGAGGAGCTCAGCCCCCTGGCCCTAGGTCGCTTCTCTCTGACCCCT
GCAGAGGGGGATACTGAGGAAGATGATGGATTTGTGGACATCCTAGAGAGTGACTTAAAG
GATGATGATGCAGTTCCCCCAGGCATGGAGAGTCTCATTAGTGCCCCACTGGTCAAGACC
TTGGAAAAGGAAGAGGAAAAGGACCTCGTCATGTACAGCAAGTGCCAGCGGCTCTTCCGC
TCTCCGTCCATGCCCTGCAGCGTGATCCGGCCCATCCTCAAGAGGCTGGAGCGGCCCCAG
GACAGGGACACGCCCGTGCAGAATAAGCGGAGGCGGAGCGTGACCCCTCCTGAGGAGCAG
CAGGAGGCTGAGGAACCTAAAGCCCGCGTCCTCCGCTCAAAATCACTGTGTCACGATGAG
ATCGAGAACCTCCTGGACAGTGACCACCGAGAGCTGATTGGAGATTACTCTAAGGCCTTC
CTCCTACAGACAGTAGACGGAAAGCACCAAGACCTCAAGTACATCTCACCAGAAACGATG
GTGGCCCTATTGACGGGCAAGTTCAGCAACATCGTGGATAAGTTTGTGATTGTAGACTGC
AGATACCCCTATGAATATGAAGGCGGGCACATCAAGACTGCGGTGAACTTGCCCCTGGAA
CGCGACGCCGAGAGCTTCCTACTGAAGAGCCCCATCGCGCCCTGTAGCCTGGACAAGAGA
GTCATCCTCATTTTCCACTGTGAATTCTCATCTGAGCGTGGGCCCCGCATGTGCCGTTTC
ATCAGGGAACGAGACCGTGCTGTCAACGACTACCCCAGCCTCTACTACCCTGAGATGTAT
ATCCTGAAAGGCGGCTACAAGGAGTTCTTCCCTCAGCACCCGAACTTCTGTGAACCCCAG
GACTACCGGCCCATGAACCACGAGGCCTTCAAGGATGAGCTAAAGACCTTCCGCCTCAAG
ACTCGCAGCTGGGCTGGGGAGCGGAGCCGGCGGGAGCTCTGTAGCCGGCTGCAGGACCAG
TGA

Clone variation with respect to NM_021873.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_004358 unedited
TTTGTCATACGTTGCACTATAGGTCGGCCGCGAATTCGGCACGAGGCATCCCTCTCCTCC
CTCGCGCCTGGCCCTGTGGCTCTTCCTCCCTCCCTCCTTCCCCCCCCCCCCACCCCTCGC
CCGCTGCCTCCCTCGGCCCAGCCAGCTGTGCCGGCGTTTGTTGGCTGCCCTGCGCCCGGC
CCTCCAGCCAGCCTTCTGCCGGCCCCGCCGCGATGGAGGTGCCCCAGCCGGAGCCCGCGC
CAGGCTCGGCTCTCAGTCCAGCAGGCGTGTGCGGTGGCGCCCAGCGTCCGGGCCACCTCC
CGGGCCTCCTGCTGGGATCTCATGGCCTCCTGGGGTCCCCGGTGCGGGCGGCCGCTTCCT
CGCCGGTCACCACCCTCACCCAGACCATGCACGACCTCGCCGGGCTCGGCAGCGAAACCC
CAAAGAGTCAGGTAGGGACCCTGCTCTTCCGCAGCCGCAGCCGCCTGACGCACCTATCCC
TGTCTCGACGGGCATCCGAATCCTCCCTGTCGTCTGAATCCTCCGAATCTTCTGATGCAG
GTCTCTGCATGGATTCCCCCAGCCCTATGGACCCCCACATGGGGGAGCAGACGTTTGAAC
AGGCCATCCAGGCAGCCAGCCGGATCATTCGAAACGAGCAGTTTGCCATCAGACGCTTCC
ACTCCATGCCGGAGAGGCTGCTGGGCCCCAGCCCCGTGCTTTGGAACATTACCAACTCCC
AGGCGCCCCGCCGTCCGGAGGAATACCGAGGCCGCCAGTGGAACTGCCACCCGCTCTCGG
GAACACACGCCGAAGGGGGCTCTGTCTCCGAAAGCCTGCTACCCCCACATACCACCCCCA
CCCCGCTTTGGTATAAAGACTCCACCCCGGTAACTTTCTCCTAAACCTTTCGGTCACGAC
TCGTCGAACAAGACTCGAAGAN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_004358 unedited
TATACAATAGGCCCGGGTGCGGTGANCGTTAAAACCCTNNNTTTTNNNCACTNGCTCGTG
TTTTATTGAACCAAGGCCCTAACAGATGACTCAGCAGGGCCTTCAAGCACAGCCCTGCCC
CCATCTTGAGATTCAGAATCCAGAGGGTGCTCAGTCCTTGGTTTAGCTGCTTCTGTGACA
TTTCCTCTTGAATAGCTCCAAACCCTAAGTGTAAATATTTTTGTCCACACAAATAGGCAC
ACATATATTCCTGCTGCAGGCTGTCATGCTCAACAAAACGCTCCCACCTGGTTTGGGTAT
GCAAGGCACTGCGCATCCACGGCCATCCACGGCCATCCACCCATCCATCCAACCTTCCAT
CCATCCGCAACAAGACAGCAGCAAGTTCTGAGCAGTCAGGCCCCAGGGTTCACAGCAGTA
GGGGCTGGGCTTCCAGCAGGCTCATGATTCAGGCCTTAACCCTTGCCCTGGGAGCCCCCA
AGGATAATAACATCCCTTTCTGGGGCAACAAAACTGGGACCGAGTGGGTAACTGATATTT
GACAGGGGAACCTAAACAGTCTACGGAAGTGTCCTGAGATGGGCGTAAAGCCACACAGAC
CAAGCACACAGGTAACACTGAAATAGGAAAGAGTAAGAGCTTCTGTTCAGGCTGGAGGCG
CTCGCATGGCGGGACAGGAAAGGGGAAAAGAGAAGGGGCAATATGGGAGACATACCACGG
TTCCTACCGAGATTATGGGCAGCCCTGCCCCGGAAGTCACAGGGCAGAGAGCTGCCTCTA
GGCCGGAAGGCAGTTAGCTTTGACCCATCTCAGGGACCCGGTTCTCCCCAGCCTTAGGTG
ACCCCACCCAAGGAACGTTTCAGACACAGGAAGAGAAGGGTTAACCCTAACAAGAACAAG
GACCTCCTGAGGACCCAAAACTGCCTTTAACTGGCCTTACCCCACTTATTAANTCAACGA
CTGGCCTCTACAAGGGTGGG
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_021873
ORF Size 1743 bp
Insert Size 2770
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_021873.2, NP_068659
RefSeq Size 3701
Locus ID 994
Cytogenetics 20p13
Domains RHOD
Protein Families Phosphatase, Druggable Genome
Protein Pathways MAPK signaling pathway, Cell cycle, Progesterone-mediated oocyte maturation
Gene Summary CDC25B is a member of the CDC25 family of phosphatases. CDC25B activates the cyclin dependent kinase CDC2 by removing two phosphate groups and it is required for entry into mitosis. CDC25B shuttles between the nucleus and the cytoplasm due to nuclear localization and nuclear export signals. The protein is nuclear in the M and G1 phases of the cell cycle and moves to the cytoplasm during S and G2. CDC25B has oncogenic properties, although its role in tumor formation has not been determined. Multiple transcript variants for this gene exist. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1), also known as CDC25B3, represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations