IL7 (NM_000880) Human Untagged Clone

CAT#: SC126145

Reviews ()
Write a review

IL7 (untagged)-Human interleukin 7 (IL7), transcript variant 1



  "NM_000880" in other vectors (6)

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name IL7 (NM_000880) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol IL7
Synonyms IL-7
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene sequence for NM_000880 edited
ACGCCTCCTTGGTGTCGTCCGCTTCCAATAACCCAGCTTGCGTCCTGCACACTTGTGGCT
TCCGTGCACACATTAACAACTCATGGTTCTAGCTCCCAGTCGCCAAGCGTTGCCAAGGCG
TTGAGAGATCATCTGGGAAGTCTTTTACCCAGAATTGCTTTGATTCAGGCCAGCTGGTTT
TTCCTGCGGTGATTCGGAAATTCGCGAATTCCTCTGGTCCTCATCCAGGTGCGCGGGAAG
CAGGTGCCCAGGAGAGAGGGGATAATGAAGATTCCATGCTGATGATCCCAAAGATTGAAC
CTGCAGACCAAGCGCAAAGTAGAAACTGAAAGTACACTGCTGGCGGATCCTACGGAAGTT
ATGGAAAAGGCAAAGCGCAGAGCCACGCCGTAGTGTGTGCCGCCCCCCTTGGGATGGATG
AAACTGCAGTCGCGGCGTGGGTAAGAGGAACCAGCTGCAGAGATCACCCTGCCCAACACA
GACTCGGCAACTCCGCGGAAGACCAGGGTCCTGGGAGTGACTATGGGCGGTGAGAGCTTG
CTCCTGCTCCAGTTGCGGTCATCATGACTACGCCCGCCTCCCGCAGACCATGTTCCATGT
TTCTTTTAGGTATATCTTTGGACTTCCTCCCCTGATCCTTGTTCTGTTGCCAGTAGCATC
ATCTGATTGTGATATTGAAGGTAAAGATGGCAAACAATATGAGAGTGTTCTAATGGTCAG
CATCGATCAATTATTGGACAGCATGAAAGAAATTGGTAGCAATTGCCTGAATAATGAATT
TAACTTTTTTAAAAGACATATCTGTGATGCTAATAAGGAAGGTATGTTTTTATTCCGTGC
TGCTCGCAAGTTGAGGCAATTTCTTAAAATGAATAGCACTGGTGATTTTGATCTCCACTT
ATTAAAAGTTTCAGAAGGCACAACAATACTGTTGAACTGCACTGGCCAGGTTAAAGGAAG
AAAACCAGCTGCCCTGGGTGAAGCCCAACCAACAAAGAGTTTGGAAGAAAATAAATCTTT
AAAGGAACAGAAAAAACTGAATGACTTGTGTTTCCTAAAGAGACTATTACAAGAGATAAA
AACTTGTTGGAATAAAATTTTGATGGGCACTAAAGAACACTGAAAAATATGGAGTGGCAA
TATAGAAACACGAACTTTAGCTGCATCCTCCAAGAATCTATCTGCTTATGCAGTTTTTCA
GAGTGGAATGCTTCCTAGAAGTTACTGAATGCACCATGGTCAAAACGGATTAGGGCATTT
GAGAAATGCATATTGTATTACTAGAAGATGAATACAAACAATGGAAACTGAATGCTCCAG
TCAACAAACTATTTCTTATATATGTGAACATTTATCAATCAGTATAATTCTGTACTGATT
TTTGTAAGACAATCCATGTAAGGTATCAGTTGCAATAATACTTCTCAAACCTGTTTAAAT
ATTTCAAGACATTAAATCTATGAAGTATATAATGGTTTCAAAGATTCAAAATTGACATTG
CTTTACTGTCAAAATAATTTTATGGCTCACTATGAATCTATTATACTGTATTAAGAGTGA
AAATTGTCTTCTTCTGTGCTGGAGATGTTTTAGAGTTAACAATGATATATGGATAATGCC
GGTGAGAATAAGAGAGTCATAAACCTTAAGTAAGCAACAGCATAACAAGGTCCAAGATAC
CTAAAAGAGATTTCAAGAGATTTAATTAATCATGAATGTGTAACACAGTGCCTTCAATAA
ATGGTATAGCAAATGTTTTGACATGAAAAAAGGACAATTTCAAAAAAATAAAATAAAATA
AAAATAAATTCACCTAGTCTAAGGATGCTAAACCTTAGTACTGAGTTACATTGTCATTTA
TATAGATTATAACTTGTCTAAATAAGTTTGCAATTTGGGAGATATATTTTTAAGATAATA
ATATATGTTTACCTTTTAATTAATGAAATATCTGTATTTAATTTTGACACTATATCTGTA
TATAAAATATTTTCATACAGCATTACAAATTGCTTACTTTGGAATACATTTCTCCTTTGA
TAAAATAAATGAGCTATGTATTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAA
>OriGene 5' read for NM_000880 unedited
NNNNCCGGGCAAAATTTGTATACGACTCACTATAGGCGGCCGCGAATCAGATCTGGTACC
GGTCCGGAATTCCCGGGNAACGCCTCCTTGGTGTCGTCCGCTTCCAATAACCCAGCTTGC
GTCCTGCACACTTGTGGCTTCCGTGCACACATTAACAACTCATGGTTCTAGCTCCCAGTC
GCCAAGCGTTGCCAAGGCGTTGAGAGATCATCTGGGAAGTCTTTTACCCAGAATTGCTTT
GATTCAGGCCAGCTGGTTTTTCCTGCGGTGATTCGGAAATTCGCGAATTCCTCTGGTCCT
CATCCAGGTGCGCGGGAAGCAGGTGCCCAGGAGAGAGGGGATAATGAAGATTCCATGCTG
ATGATCCCAAAGATTGAACCTGCAGACCAAGCGCAAAGTAGAAACTGAAAGTACACTGCT
GGCGGATCCTACGGAAGTTATGGAAAAGGCAAAGCGCAGAGCCACGCCGTAGTGTGTGCC
GCCCCCCTTGGGATGGATGAAACTGCAGTCGCGGCGTGGGTAAGAGGAACCAGCTGCAGA
GATCACCCTGCCCAACACAGACTCGGCAACTCCGCGGAAGACCAGGGTCCTGGGAGTGAC
TATGGGCGGTGAGAGCTTGCTCCTGCTCCAGTTGCGGTCATCATGACTACGCCCGCCTCC
CGCAGACCATGTTCCATGTTTCTTTTAGGTATATCTTTGGACTTCCTCCCCTGATCCTTG
TTCTGTTGCCAGTAGCATCATCTGATTGTGATATTGAAGGTAAAGATGGCAAACAATATG
AGAGTGTTCTAATGGTCAGCATCGATCAATTATTGGACAGCATGAAAGAATTGGTACGCA
TTGCCTGAATATGAATTTAACA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000880
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000880.2, NP_000871.1
RefSeq Size 2116 bp
RefSeq ORF 534 bp
Locus ID 3574
Cytogenetics 8q21.13
Protein Families Druggable Genome, Secreted Protein
Protein Pathways Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway
Gene Summary The protein encoded by this gene is a cytokine important for B and T cell development. This cytokine and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. This cytokine is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRB) during early T cell development. This cytokine can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes. Knockout studies in mice suggested that this cytokine plays an essential role in lymphoid cell survival. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional splice variants have been described but their presence in normal tissues has not been confirmed. [provided by RefSeq, Dec 2010]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).

Citations (1)

Other Versions

Frequently bought together (2)
Anti-Human IL-7 Rabbit Polyclonal Antibody
    • 100 ug

USD 285.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools