Cytochrome P450 3A4(CYP3A4) (NM_017460) Human Untagged Clone

CAT#: SC125488

CYP3A4 (untagged)-Human cytochrome P450, family 3, subfamily A, polypeptide 4 (CYP3A4), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Cytochrome P450 3A4(CYP3A4) (NM_017460) Human Untagged Clone
Symbol CYP3A4
Synonyms CP33; CP34; CYP3A; CYP3A3; CYPIIIA3; CYPIIIA4; HLP; NF-25; P450C3; P450PCN1
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_017460 edited
CGGCCGCGAATTCGGCACGAGAAGCTCCATGCACATAGCCCAGCAAAGAGCAACACAGAG
CTGAAAGGAAGACTCAGAGGAGAGAGATAAGTAAGGAAAGTAGTGATGGCTCTCATCCCA
GACTTGGCCATGGAAACCTGGCTTCTCCTGGCTGTCAGCCTGGTGCTCCTCTATCTATAT
GGAACCCATTCACATGGACTTTTTAAGAAGCTTGGAATTCCAAGGCCCACACCTCTGCCT
TTTTTGGGAAATATTTTGTCCTACCATAAGGGCTTTTGTATGTTTGACATGGAATGTCAT
AAAAAGTATGGAAAAGTGTGGGGCTTTTATGATGGTCAACAGCCTGTGCTGGCTATCACA
GATCCTGACATGATCAAAACAGTGCTAGTGAAAGAATGTTATTCTGTCTTCACAAACCGG
AGGCCTTTTGGTCCAGTGGGATTTATGAAAAGTGCCATCTCTATAGCTGAGGATGAAGAA
TGGAAGAGATTACGATCATTGCTGTCTCCAACCTTCACCAGTGGAAAACTCAAGGAGATG
GTCCCTATCATTGCCCAGTATGGAGATGTGTTGGTGAGAAATCTGAGGCGGGAAGCAGAG
ACAGGCAAGCCTGTCACCTTGAAAGACGTCTTTGGGGCCTACAGCATGGATGTGATCACT
AGCACATCATTTGGAGTGAACATCGACTCTCTCAACAATCCACAAGACCCCTTTGTGGAA
AACACCAAGAAGCTTTTAAGATTTGATTTTTTGGATCCATTCTTTCTCTCAATAACAGTC
TTTCCATTCCTCATCCCAATTCTTGAAGTATTAAATATCTGTGTGTTTCCAAGAGAAGTT
ACAAATTTTTTAAGAAAATCTGTAAAAAGGATGAAAGAAAGTCGCCTCGAAGATACACAA
AAGCACCGAGTGGATTTCCTTCAGCTGATGATTGACTCTCAGAATTCAAAAGAAACTGAG
TCCCACAAAGCTCTGTCCGATCTGGAGCTCGTGGCCCAATCAATTATCTTTATTTTTGCT
GGCTATGAAACCACGAGCAGTGTTCTCTCCTTCATTATGTATGAACTGGCCACTCACCCT
GATGTCCAGCAGAAACTGCAGGAGGAAATTGATGCAGTTTTACCCAATAAGGCACCACCC
ACCTATGATACTGTGCTACAGATGGAGTATCTTGACATGGTGGTGAATGAAACGCTCAGA
TTATTCCCAATTGCTATGAGACTTGAGAGGGTCTGCAAAAAAGATGTTGAGATCAATGGG
ATGTTCATTCCCAAAGGGGTGGTGGTGATGATTCCAAGCTATGCTCTTCACCGTGACCCA
AAGTACTGGACAGAGCCTGAGAAGTTCCTCCCTGAAAGATTCAGCAAGAAGAACAAGGAC
AACATAGATCCTTACATATACACACCCTTTGGAAGTGGACCCAGAAACTGCATTGGCATG
AGGTTTGCTCTCATGAACATGAAACTTGCTCTAATCAGAGTCCTTCAGAACTTCTCCTTC
AAACCTTGTAAAGAAACACAGATCCCCCTGAAATTAAGCTTAGGAGGACTTCTTCAACCA
GAAAAACCCGTTGTTCTAAAGGTTGAGTCAAGGGATGGCACCGTAAGTGGAGCCTGAATT
TTCCTAAGGACTTCTGCTTTGCTCTTCAAGAAATCTGTGCCTGAGAACACCAGAGACCTC
AAATTACTTTGTGAATAGAACTCTGAAATGAAGATGGGCTTCATCCAATGGACTGCATAA
ATAACCGGGGATTCTGTACATGCATTGAGCTCTCTCATTGTCTGTGTAGAGTGTTATACT
TGGGAATATAAAGGAGGTGACCAAATCAGTGTGAGGAGGTAGATTTGGCTCCTTTGCTTC
TCACGGGACTATTTCCACCACCCCCAGTTAGCACCATTAACTCCTCCTGAGCTTTGATAA
GAGAATCAACATTTCTCAATAATTTCCTCCCCAAATTATTAATGAAAATAAGAATTATTT
TGATGGCTCTAACAATGACATTTATATCACATGTTTTCTCTGGAGTATTCTATAAGTTTT
ATGTTAAATCAATAAAGACCCCTTTTCAAAAGTAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAACTCG
5' Read Nucleotide Sequence
>OriGene 5' read for NM_017460 unedited
AAGTTCAAATTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGANAAGCTCCAT
GCACATAGCCCAGCAAAAAGCAACACAGAGCTGAAAGGAAGACTCAGAGGAGAGAGATAA
GTAAGGAAAGTAGTGATGGCTCTCATCCCAGACTTGGCCATGGAAACCTGGCTTCTCCTG
GCTGTCAGCCTGGTGCTCCTCTATCTATATGGAACCCATTCACATGGACTTTTTAAGAAG
CTTGGAATTCCAAGGCCCACACCTCTGCCTTTTTTGGGAAATATTTTGTCCTACCATAAG
GGCTTTTGTATGTTTGACATGGAATGTCATAAAAAGTATGGAAAAGTGTGGGGCTTTTAT
GATGGTCAACAGCCTGTGCTGGCTATCACAGATCCTGACATGATCAAAACAGTGCTAGTG
AAAGAATGTTATTCTGTCTTCACAAACCGGAGGCCTTTTGGTCCAGTGGGATTTATGAAA
AGTGCCATCTCTATAGCTGAGGATGAAGAATGGAAGAGATTACGATCATTGCTGTCTCCA
ACCTTCACCAGTGGAAAACTCAAGGAGATGGTCCCTATCATTGCCCAGTATGGAGATGTG
TTGGTGAGAAATCTGAGGCGGGAAGCAGAGACAGGCAAGCCTGTCACCTTGAAAGACGTC
TTTGGGGCCTACAGCATGGATGTGATCACTAGCACATCATTTGGAGTGAACATCGACTCT
CTCAACAATCCACAAGACCNCTTTGTGGAAAACACCAAGAAGCTTTTAAGATTTGATTTT
TTGGATCCATTCTTTCTCTCATAACAGTCTTTCCATTCCTCATCCNNNATTCTGNAGTAT
TAAATATCTGTGTGNTTTCAAGAGAAGTTACAAATTTTTTAAGAAAATCTGTAAAAGGAT
GAAAGAAAGTCGCTCGAAGATCACN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_017460 unedited
NNATTATTTTNACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTACTTTTGAAAAGGGGTCTTTATTGATTTAACATAAAACTTATAGAATACTCC
AGAGAAAACATGTGATATAAATGTCATTGTTAGAGCCATCAAAATAATTCTTATTTTCAT
TAATAATTTGGGGAGGAAATTATTGAGAAATGTTGATTCTCTTATCAAAGCTCAGGAGGA
GTTAATGGTGCTAACTGGGGGTGGTGGAAATAGTCCCGTGAGAAGCAAAGGAGCCAAATC
TACCTCCTCACACTGATTTGGTCACCTCCTTTATATTCCCAAGTATAACACTCTACACAG
ACAATGAGAGAGCTCAATGCATGTACAGAATCCCCGGTTATTTATGCAGTCCATTGGATG
AAGCCCATCTTCATTTCAGAGTTCTATTCACAAAGTAATTTGAGGTCTCTGGTGTTCTCA
GGCACAGATTTCTTGAAGAGCAAAGCAGAAGTCCTTAGGAAAATTCAGGCTCCACTTACG
GTGCCATCCCTTGACTCAACCTTTAGAACAACGGGTTTTTCTGGTTGAAGAAGTCCTCCT
AAGCTTAATTTCAGGGGGATNCTGTGTTTCTTTACAAGGTTTGAAGGAGAAGTTCTGAAG
GACTCTGATTAGAGCAAGTTTCATGTTCATGAGAGCAAACCTCATGCCAATGCAGTTTCT
GGGTCCACTTCCAAGGGTGTGTATATGTAAGGATCTATNGTGNCCTTGNTCTTCTTGCTG
AATCTTTCAGGGNAGAAACTCTCANGCTCTGTCAGTACTTTTGGTCACGGTGAAAGCATA
NCTTGGAATCATCACACCACCCCTTTGGNAATGACATCCCCATGATCTCACATCTTTTTT
GCAGACCTCTCAGTCTATAGCATTGGGAATATCTGACC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_017460
ORF Size 1512 bp
Insert Size 2150
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_017460.3, NP_059488
RefSeq Size 2768
RefSeq ORF 1512
Locus ID 1576
Cytogenetics 7q22.1
Domains p450
Protein Families ES Cell Differentiation/IPS, Transmembrane, P450, Druggable Genome
Protein Pathways Linoleic acid metabolism, Retinol metabolism, Metabolism of xenobiotics by cytochrome P450, Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Metabolic pathways
Gene Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases that catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by glucocorticoids and some pharmacological agents. This enzyme is involved in the metabolism of approximately half the drugs in use today, including acetaminophen, codeine, cyclosporin A, diazepam and erythromycin. The enzyme also metabolizes some steroids and carcinogens. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Previously another CYP3A gene, CYP3A3, was thought to exist; however, it is now thought that this sequence represents a transcript variant of CYP3A4. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations