IKK beta(IKBKB) (NM_001556) Human Untagged Clone

CAT#: SC125322

IKBKB (untagged)-Human inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta (IKBKB), transcript variant 1

USD 1,442


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name IKK beta(IKBKB) (NM_001556) Human Untagged Clone
Symbol IKBKB
Synonyms IKK-beta; IKK2; IKKB; IMD15; NFKBIKB
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_001556 edited
ATGAGCTGGTCACCTTCCCTGACAACGCAGACATGTGGGGCCTGGGAAATGAAAGAGCGC
CTTGGGACAGGGGGATTTGGAAATGTCATCCGATGGCACAATCAGGAAACAGGTGAGCAG
ATTGCCATCAAGCAGTGCCGGCAGGAGCTCAGCCCCCGGAACCGAGAGCGGTGGTGCCTG
GAGATCCAGATCATGAGAAGGCTGACCCACCCCAATGTGGTGGCTGCCCGAGATGTCCCT
GAGGGGATGCAGAACTTGGCGCCCAATGACCTGCCCCTGCTGGCCATGGAGTACTGCCAA
GGAGGAGATCTCCGGAAGTACCTGAACCAGTTTGAGAACTGCTGTGGTCTGCGGGAAGGT
GCCATCCTCACCTTGCTGAGTGACATTGCCTCTGCGCTTAGATACCTTCATGAAAACAGA
ATCATCCATCGGGATCTAAAGCCAGAAAACATCGTCCTGCAGCAAGGAGAACAGAGGTTA
ATACACAAAATTATTGACCTAGGATATGCCAAGGAGCTGGATCAGGGCAGTCTTTGCACA
TCATTCGTGGGGACCCTGCAGTACCTGGCCCCAGAGCTACTGGAGCAGCAGAAGTACACA
GTGACCGTCGACTACTGGAGCTTCGGCACCCTGGCCTTTGAGTGCATCACGGGCTTCCGG
CCCTTCCTCCCCAACTGGCAGCCCGTGCAGTGGCATTCAAAAGTGCGGCAGAAGAGTGAG
GTGGACATTGTTGTTAGCGAAGACTTGAATGGAACGGTGAAGTTTTCAAGCTCTTTACCC
TACCCCAATAATCTTAACAGTGTCCTGGCTGAGCGACTGGAGAAGTGGCTGCAACTGATG
CTGATGTGGCACCCCCGACAGAGGGGCACGGATCCCACGTATGGGCCCAATGGCTGCTTC
AAGGCCCTGGATGACATCTTAAACTTAAAGCTGGTTCATATCTTGAACATGGTCACGGGC
ACCATCCACACCTACCCTGTGACAGAGGATGAGAGTCTGCAGAGCTTGAAGGCCAGAATC
CAACAGGACACGGGCATCCCAGAGGAGGACCAGGAGCTGCTGCAGGAAGCGGGCCTGGCG
TTGATCCCCGATAAGCCTGCCACTCAGTGTATTTCAGACGGCAAGTTAAATGAGGGCCAC
ACATTGGACATGGATCTTGTTTTTCTCTTTGACAACAGTAAAATCACCTATGAGACTCAG
ATCTCCCCACGGCCCCAACCTGAAAGTGTCAGCTGTATCCTTCAAGAGCCCAAGAGGAAT
CTCGCCTTCTTCCAGCTGAGGAAGGTGTGGGGCCAGGTCTGGCACAGCATCCAGACCCTG
AAGGAAGATTGCAACCGGCTGCAGCAGGGACAGCGAGCCGCCATGATGAATCTCCTCCGA
AACAACAGCTGCCTCTCCAAAATGAAGAATTCCATGGCTTCCATGTCTCAGCAGCTCAAG
GCCAAGTTGGATTTCTTCAAAACCAGCATCCAGATTGACCTGGAGAAGTACAGCGAGCAA
ACCGAGTTTGGGATCACATCAGATAAACTGCTGCTGGCCTGGAGGGAAATGGAGCAGGCT
GTGGAGCTCTGTGGGCGGGAGAACGAAGTGAAACTCCTGGTAGAACGGATGATGGCTCTG
CAGACCGACATTGTGGACTTACAGAGGAGCCCCATGGGCCGGAAGCAGGGGGGAACGCTG
GACGACCTAGAGGAGCAAGCAAGGGAGCTGTACAGGAGACTAAGGGAAAAACCTCGAGAC
CAGCGAACTGAGGGTGACAGTCAGGAAATGGTACGGCTGCTGCTTCAGGCAATTCAGAGC
TTCGAGAAGAAAGTGCGAGTGATCTATACGCAGCTCAGTAAAACTGTGGTTTGCAAGCAG
AAGGCGCTGGAACTGTTGCCCAAGGTGGAAGAGGTGGTGAGCTTAATGAATGAGGATGAG
AAGACTGTTGTCCGGCTGCAGGAGAAGCGGCAGAAGGAGCTCTGGAATCTCCTGAAGATT
GCTTGTAGCAAGGTCCGTGGTCCTGTCAGTGGAAGCCCGGATAGCATGAATGCCTCTCGA
CTTAGCCAGCCTGGGCAGCTGATGTCTCAGCCCTCCACGGCCTCCAACAGCTTACCTGAG
CCAGCCAAGAAGAGTGAAGAACTGGTGGCTGAAGCACATAACCTCTGCACCCTGCTAGAA
AATGCCATACAGGACACTGTGAGGGAACAAGACCAGAGTTTCACGGCCCTAGACTGGAGC
TGGTTACAGACGGAAGAAGAAGAGCACAGCTGCCTGGAGCAGGCCTCATGA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001556 unedited
GCCGCCCCAGCCCCGCCTTCCCCGCCCCGGGGAGCCCGCCCCCTGCCCCGCGTCCCTGCC
GACAGAGTTAGCACGACATCAGTATGAGCTGGTCACCTTCCCTGACAACGCAGACATGTG
GGGCCTGGGAAATGAAAGAGCGCCTTGGGACAGGGGGATTTGGAAATGTCATCCGATGGC
ACAATCAGGAAACAGGTGAGCAGATTGCCATCAAGCAGTGCCGGCAGGAGCTCAGCCCCC
GGAACCGAGAGCGGTGGTGCCTGGAGATCCAGATCATGAGAAGGCTGACCCACCCCAATG
TGGTGGCTGCCCGAGATGTCCCTGAGGGGATGCAGAACTTGGCGCCCAATGACCTGCCCC
TGCTGGCCATGGAGTACTGCCAAAGAGGAGATCTCCGGAAGTACCTGAACCAGTTTGAGA
ACTGCTGTGGTCTGCGGGAAAGGTGCATCCTCACCTTGCTGAGAGACATTGCCTCTGCGC
TTANATACCTTCTTGAAAACAAAATCATCCATCGGGATCTAAAGCCCAAAAACATCTTCC
TGCAGCAAGGAGAACAAAGGTTAATCCACAAAATTATTGCCCTATGATTTGCCCACGGAG
CTGGATTAGGGCAGTCTTTTCACATAATTCTGGGGGACCCTGGATTCCTGGCCCCAAACT
TCTGGAGCCAAAAAGTACCACGGACCGTCGCTATTGGACTTCGGCCCCTGTCTTTGATGG
ATAAGGGCTTTCGGCCTTTCTTCCCACTGGCAGCCCGGGGTGGTGTTTAAAATCCGGGAA
AAAAGAGGGGGCTTGTTTGTCCAAACCTAATTGAACGTA
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001556 unedited
NGGCCTAGGGTCTTTATAACGGCCTCCTCATTGGNAAGTTAATACATGTTTCACACACAC
AATCAGCAGGAGAAAAGTTTCTATAGCCAAATGACATTGATAAACAGTGTTCTTACACAA
AGTTAAGCCTGTTTCTTTATTATAAGACTTTTCAGATACTTTCCCAGTGCATAGTGTGAA
TCTCCACAAAGCAAGTGAAACATGAATAGCTCCCTAAACTTACTTGACCACAGAATGCTT
CATTCTATCTCCATGGAAACCACTTGTGAAAGTCTCCTACTCCAACTTTCTTCTCCAACA
AAACTCACCTGTTTGTGATCATCTGAACTCATTTTGTGCTCTTGCCTTTATATAAAAGAG
AAGTTCTGTGAAATGTTGAAGAAGCAGGGTTATGGCACTAGTAATGATCCAGGCACTATA
CACATTGTTAACATTTTCCATTATTTTAGTTCAGAAGCCCTAACCATATGTATTCTAACA
GTGGATTGTGGAACCCACTATGAGTGTTTGAGACGTGTCGCCNTATACGGGAGCTATTTT
GTATATGAATCCATTGATTATCCCTGCTAGTTGCCGTGTGAGACGCCCACTCACCGGGCG
AGCGCCCTTGCTCGGGCCGGCCTGGGGACCCGGTCGGGCGCCGGCCGGCAGGTTGCTCGG
CCCTTGCCCGTGCTGGGGGCGGGCTTTGTCTCTTCTCTCCCTAGGTTGCGTGTGGGTCGC
CCCGCTTGTCGCTGGTGGCGTTTTTCCGTCGGGCGCTTTCGGCGCTTCTTCCTCTNNTAC
TGCCGCGTGTGGTCGGCACCCCTGCATCTCCCCNCGTTGGTGCTCCCTTTGATGGACTGG
GCGCGGCGCCGCTCCGATCATTTGTTGCCGTCTTTTCCCGCCCTTTGCCGCTTTTCGTCT
CCCCCCTCCCCCTTTTTTCCCGCCTTTGTTTTATATAGACGCTTAGCCAGAACAACA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001556
ORF Size 2271 bp
Insert Size 4500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001556.1, NP_001547
RefSeq Size 3916
RefSeq ORF 2271
Locus ID 3551
Cytogenetics 8p11.21
Protein Families Protein Kinase, Transcription Factors, Druggable Genome
Protein Pathways MAPK signaling pathway, Chemokine signaling pathway, Apoptosis, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, RIG-I-like receptor signaling pathway, Cytosolic DNA-sensing pathway, T cell receptor signaling pathway, B cell receptor signaling pathway, Neurotrophin signaling pathway, Insulin signaling pathway, Adipocytokine signaling pathway, Type II diabetes mellitus, Epithelial cell signaling in Helicobacter pylori infection, Pathways in cancer, Pancreatic cancer, Prostate cancer, Chronic myeloid leukemia, Acute myeloid leukemia, Small cell lung cancer
Gene Summary The protein encoded by this gene phosphorylates the inhibitor in the inhibitor/NF-kappa-B complex, causing dissociation of the inhibitor and activation of NF-kappa-B. The encoded protein itself is found in a complex of proteins. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (1) encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.