Ephrin A1 (EFNA1) (NM_004428) Human Untagged Clone

CAT#: SC125307

Reviews ()
Write a review

EFNA1 (untagged)-Human ephrin-A1 (EFNA1), transcript variant 1



Reconstitution Protocol

USD 429.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EFNA1
Synonyms B61; ECKLG; EFL1; EPLG1; GMAN; LERK-1; LERK1; TNFAIP4
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC125307 sequence for NM_004428 edited (data generated by NextGen Sequencing)
ATGGAGTTCCTCTGGGCCCCTCTCTTGGGTCTGTGCTGCAGTCTGGCCGCTGCTGATCGC
CACACCGTCTTCTGGAACAGTTCAAATCCCAAGTTCCGGAATGAGGACTACACCATACAT
GTGCAGCTGAATGACTACGTGGACATCATCTGTCCGCACTATGAAGATCACTCTGTGGCA
GACGCTGCCATGGAGCAGTACATACTGTATCTGGTGGAGCATGAGGAGTACCAGCTGTGC
CAGCCCCAGTCCAAGGACCAAGTCCGCTGGCAGTGCAACCGGCCCAGTGCCAAGCATGGC
CCGGAGAAGCTGTCTGAGAAGTTCCAGCGCTTCACACCTTTCACCCTGGGCAAGGAGTTC
AAAGAAGGACACAGCTACTACTACATCTCCAAACCCATCCACCAGCATGAAGACCGCTGC
TTGAGGTTGAAGGTGACTGTCAGTGGCAAAATCACTCACAGTCCTCAGGCCCATGACAAT
CCACAGGAGAAGAGACTTGCAGCAGATGACCCAGAGGTGCGGGTTCTACATAGCATCGGT
CACAGTGCTGCCCCACGCCTCTTCCCACTTGCCTGGACTGTGCTGCTCCTTCCACTTCTG
CTGCTGCAAACCCCGTGA

Clone variation with respect to NM_004428.2
210 c=>t
>OriGene 5' read for NM_004428 unedited
TCTATCACCCGCCCGTTGNCGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAA
GCAGAGCTCATTTAGGTGACACTATAGAATACAAGCTACTTGTTCTTTTTGCAGCGGCCG
CGAATTCGGCACGAGGGCTGACTGCGCCGCGGAGAAAGCCAGTGGGAACCCAGACCCATA
GGAGACCCGCGTTCCCGCTCGGCCTGGCCAGGCCCCGCGCTATGGAGTTCCTCTGGGCCC
CTCTCTTGGGTCTGTGCTGCAGTCTGGCCGCTGCTGATCGCCACACCGTCTTCTGGAACA
GTTCAAATCCCAAGTTCCGGAATGAGGACTACACCATACATGTGCAGCTGAATGACTACG
TGGACATCATCTGTCCGCACTATGAAGATCACTCTGTGGCAGACGCTGCCATGGAGCAGT
ACATACTGTATCTGGTGGAGCATGAGGAGTACCAGCTGTGCCAGCCCCAGTCCAAGGACC
AAGTCCGCTGGCAGTGCAACCGGCCCAGTGCCAAGCATGGCCCGGAGAAGCTGTCTGAGA
AGTTTCAGCGCTTCACACCTTTCACCCTGGGCAAGGAGTTCANAGAAGGACACAGCTACT
ACTACATCTCCAAACCCATCCACCAGCATGAAGACCGCTGCTTGAGGTTGAAGGTGACTG
TCAGTGGCAAAATCACTCACAGTCCTCAGGCCCATGACAATCCACAGGAGAAGAGACTTG
CAGCAGATGACCCAGAGGTGCGGGTTCTACATAGCATCGGTCACAGTGCTGCCCCACGCT
CTTCCCACTTTGCTGAACTGTGCTGCTCCTTTCACTTCTNTGCTGCGAACCCCGTGGAGG
TGTGTTGCCACACCTGGCTTTATGAGGGACAGGCTTGANAAGGGAACAGGCCTCCAAACT
GGTCTGGGGCCATTTCAAAGCCCCCAGCCTGGGAACAATCCCC
Restriction Sites ECoRI-NOT     
ACCN NM_004428
Insert Size 800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_004428.2, NP_004419.2
RefSeq Size 1590 bp
RefSeq ORF 618 bp
Locus ID 1942
UniProt ID P20827
Cytogenetics 1q22
Domains Ephrin
Protein Families Druggable Genome
Protein Pathways Axon guidance
Gene Summary This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNA class ephrin which binds to the EPHA2, EPHA4, EPHA5, EPHA6, and EPHA7 receptors. Two transcript variants that encode different isoforms were identified through sequence analysis. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (a).
Other products for "EFNA1"
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.