MRP3(ABCC3) (NM_003786) Human Untagged Clone

CAT#: SC125262

ABCC3 (untagged)-Human ATP-binding cassette, sub-family C (CFTR/MRP), member 3 (ABCC3), transcript variant 1

USD 1,041.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MRP3(ABCC3) (NM_003786) Human Untagged Clone
Symbol ABCC3
Synonyms ABC31; cMOAT2; EST90757; MLP2; MOAT-D; MRP3
Vector pCMV6-XL4
Sequence Data
>OriGene ORF within SC125262 sequence for NM_003786 edited (data generated by NextGen Sequencing)
ATGGACGCCCTGTGCGGTTCCGGGGAGCTCGGCTCCAAGTTCTGGGACTCCAACCTGTCT
GTGCACACAGAAAACCCGGACCTCACTCCCTGCTTCCAGAACTCCCTGCTGGCCTGGGTG
CCCTGCATCTACCTGTGGGTCGCCCTGCCCTGCTACTTGCTCTACCTGCGGCACCATTGT
CGTGGCTACATCATCCTCTCCCACCTGTCCAAGCTCAAGATGGTCCTGGGTGTCCTGCTG
TGGTGCGTCTCCTGGGCGGACCTTTTTTACTCCTTCCATGGCCTGGTCCATGGCCGGGCC
CCTGCCCCTGTTTTCTTTGTCACCCCCTTGGTGGTGGGGGTCACCATGCTGCTGGCCACC
CTGCTGATACAGTATGAGCGGCTGCAGGGCGTACAGTCTTCGGGGGTCCTCATTATCTTC
TGGTTCCTGTGTGTGGTCTGCGCCATCGTCCCATTCCGCTCCAAGATCCTTTTAGCCAAG
GCAGAGGGTGAGATCTCAGACCCCTTCCGCTTCACCACCTTCTACATCCACTTTGCCCTG
GTACTCTCTGCCCTCATCTTGGCCTGCTTCAGGGAGAAACCTCCATTTTTCTCCGCAAAG
AATGTCGACCCTAACCCCTACCCTGAGACCAGCGCTGGCTTTCTCTCCCGCCTGTTTTTC
TGGTGGTTCACAAAGATGGCCATCTATGGCTACCGGCATCCCCTGGAGGAGAAGGACCTC
TGGTCCCTAAAGGAAGAGGACAGATCCCAGATGGTGGTGCAGCAGCTGCTGGAGGCATGG
AGGAAGCAGGAAAAGCAGACGGCACGACACAAGGCTTCAGCAGCACCTGGGAAAAATGCC
TCCGGCGAGGACGAGGTGCTGCTGGGTGCCCGGCCCAGGCCCCGGAAGCCCTCCTTCCTG
AAGGCCCTGCTGGCCACCTTCGGCTCCAGCTTCCTCATCAGTGCCTGCTTCAAGCTTATC
CAGGACCTGCTCTCCTTCATCAATCCACAGCTGCTCAGCATCCTGATCAGGTTTATCTCC
AACCCCATGGCCCCCTCCTGGTGGGGCTTCCTGGTGGCTGGGCTGATGTTCCTGTGCTCC
ATGATGCAGTCGCTGATCTTACAACACTATTACCACTACATCTTTGTGACTGGGGTGAAG
TTTCGTACTGGGATCATGGGTGTCATCTACAGGAAGGCTCTGGTTATCACCAACTCAGTC
AAACGTGCGTCCACTGTGGGGGAAATTGTCAACCTCATGTCAGTGGATGCCCAGCGCTTC
ATGGACCTTGCCCCCTTCCTCAATCTGCTGTGGTCAGCACCCCTGCAGATCATCCTGGCG
ATCTACTTCCTCTGGCAGAACCTAGGTCCCTCTGTCCTGGCTGGAGTCGCTTTCATGGTC
TTGCTGATTCCACTCAACGGAGCTGTGGCCGTGAAGATGCGCGCCTTCCAGGTAAAGCAA
ATGAAATTGAAGGACTCGCGCATCAAGCTGATGAGTGAGATCCTGAACGGCATCAAGGTG
CTGAAGCTGTACGCCTGGGAGCCCAGCTTCCTGAAGCAGGTGGAGGGCATCAGGCAGGGT
GAGCTCCAGCTGCTGCGCACGGCGGCCTACCTCCACACCACAACCACCTTCACCTGGATG
TGCAGCCCCTTCCTGGTGACCCTGATCACCCTCTGGGTGTACGTGTACGTGGACCCAAAC
AATGTGCTGGACGCCGAGAAGGCCTTTGTGTCTGTGTCCTTGTTTAATATCTTAAGACTT
CCCCTCAACATGCTGCCCCAGTTAATCAGCAACCTGACTCAGGCCAGTGTGTCTCTGAAA
CGGATCCAGCAATTCCTGAGCCAAGAGGAACTTGACCCCCAGAGTGTGGAAAGAAAGACC
ATCTCCCCAGGCTATGCCATCACCATACACAGTGGCACCTTCACCTGGGCCCAGGACCTG
CCCCCCACTCTGCACAGCCTAGACATCCAGGTCCCGAAAGGGGCACTGGTGGCCGTGGTG
GGGCCTGTGGGCTGTGGGAAGTCCTCCCTGGTGTCTGCCCTGCTGGGAGAGATGGAGAAG
CTAGAAGGCAAAGTGCACATGAAGGGCTCCGTGGCCTATGTGCCCCAGCAGGCATGGATC
CAGAACTGCACTCTTCAGGAAAACGTGCTTTTCGGCAAAGCCCTGAACCCCAAGCGCTAC
CAGCAGACTCTGGAGGCCTGTGCCTTGCTAGCTGACCTGGAGATGCTGCCTGGTGGGGAT
CAGACAGAGATTGGAGAGAAGGGCATTAACCTGTCTGGGGGCCAGCGGCAGCGGGTCAGT
CTGGCTCGAGCTGTTTACAGTGATGCCGATATTTTCTTGCTGGATGACCCACTGTCCGCG
GTGGACTCTCATGTGGCCAAGCACATCTTTGACCACGTCATCGGGCCAGAAGGCGTGCTG
GCAGGCAAGACGCGAGTGCTGGTGACGCACGGCATTAGCTTCCTGCCCCAGACAGACTTC
ATCATTGTGCTAGCTGATGGACAGGTGTCTGAGATGGGCCCGTACCCAGCCCTGCTGCAG
CGCAACGGCTCCTTTGCCAACTTTCTCTGCAACTATGCCCCCGATGAGGACCAAGGGCAC
CTGGAGGACAGCTGGACCGCGTTGGAAGGTGCAGAGGATAAGGAGGCACTGCTGATTGAA
GACACACTCAGCAACCACACGGATCTGACAGACAATGATCCAGTCACCTATGTGGTCCAG
AAGCAGTTTATGAGACAGCTGAGTGCCCTGTCCTCAGATGGGGAGGGACAGGGTCGGCCT
GTACCCCGGAGGCACCTGGGTCCATCAGAGAAGGTGCAGGTGACAGAGGCGAAGGCAGAT
GGGGCACTGACCCAGGAGGAGAAAGCAGCCATTGGCACTGTGGAGCTCAGTGTGTTCTGG
GATTATGCCAAGGCCGTGGGGCTCTGTACCACGCTGGCCATCTGTCTCCTGTATGTGGGT
CAAAGTGCGGCTGCCATTGGAGCCAATGTGTGGCTCAGTGCCTGGACAAATGATGCCATG
GCAGACAGTAGACAGAACAACACTTCCCTGAGGCTGGGCGTCTATGCTGCTTTAGGAATT
CTGCAAGGGTTCTTGGTGATGCTGGCAGCCATGGCCATGGCAGCGGGTGGCATCCAGGCT
GCCCGTGTGTTGCACCAGGCACTGCTGCACAACAAGATACGCTCGCCACAGTCCTTCTTT
GACACCACACCATCAGGCCGCATCCTGAACTGCTTCTCCAAGGACATCTATGTCGTTGAT
GAGGTTCTGGCCCCTGTCATCCTCATGCTGCTCAATTCCTTCTTCAACGCCATCTCCACT
CTTGTGGTCATCATGGCCAGCACGCCGCTCTTCACTGTGGTCATCCTGCCCCTGGCTGTG
CTCTACACCTTAGTGCAGCGCTTCTATGCAGCCACATCACGGCAACTGAAGCGGCTGGAA
TCAGTCAGCCGCTCACCTATCTACTCCCACTTTTCGGAGACAGTGACTGGTGCCAGTGTC
ATCCGGGCCTACAACCGCAGCCGGGATTTTGAGATCATCAGTGATACTAAGGTGGATGCC
AACCAGAGAAGCTGCTACCCCTACATCATCTCCAACCGGTGGCTGAGCATCGGAGTGGAG
TTCGTGGGGAACTGCGTGGTGCTCTTTGCTGCACTATTTGCCGTCATCGGGAGGAGCAGC
CTGAACCCGGGGCTGGTGGGCCTTTCTGTGTCCTACTCCTTGCAGGTGACATTTGCTCTG
AACTGGATGATACGAATGATGTCAGATTTGGAATCTAACATCGTGGCTGTGGAGAGGGTC
AAGGAGTACTCCAAGACAGAGACAGAGGCGCCCTGGGTGGTGGAAGGCAGCCGCCCTCCC
GAAGGTTGGCCCCCACGTGGGGAGGTGGAGTTCCGGAATTATTCTGTGCGCTACCGGCCG
GGCCTAGACCTGGTGCTGAGAGACCTGAGTCTGCATGTGCACGGTGGCGAGAAGGTGGGG
ATCGTGGGCCGCACTGGGGCTGGCAAGTCTTCCATGACCCTTTGCCTGTTCCGCATCCTG
GAGGCGGCAAAGGGTGAAATCCGCATTGATGGCCTCAATGTGGCAGACATCGGCCTCCAT
GACCTGCGCTCTCAGCTGACCATCATCCCGCAGGACCCCATCCTGTTCTCGGGGACCCTG
CGCATGAACCTGGACCCCTTCGGCAGCTACTCAGAGGAGGACATTTGGTGGGCTTTGGAG
CTGTCCCACCTGCACACGTTTGTGAGCTCCCAGCCGGCAGGCCTGGACTTCCAGTGCTCA
GAGGGCGGGGAGAATCTCAGCGTGGGCCAGAGGCAGCTCGTGTGCCTGGCCCGAGCCCTG
CTCCGCAAGAGCCGCATCCTGGTTTTAGACGAGGCCACAGCTGCCATCGACCTGGAGACT
GACAACCTCATCCAGGCTACCATCCGCACCCAGTTTGATACCTGCACTGTCCTGACCATC
GCACACCGGCTTAACACTATCATGGACTACACCAGGGTCCTGGTCCTGGACAAAGGAGTA
GTAGCTGAATTTGATTCTCCAGCCAACCTCATTGCAGCTAGAGGCATCTTCTACGGGATG
GCCAGAGATGCTGGACTTGCCTAA

Clone variation with respect to NM_003786.3
>OriGene 5' read for NM_003786 unedited
GGGGAAATCATTTACCCGCCCGTTGCCGCAATAGGGCGTAGGCGTGTACGGTGGGAGGTC
TATATAAGCAGAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGG
CGGCCGCGAATTCGGCACCAGGCGCTCGCCTTCCTTGCAGCCGCGCCTCGGCCCCATGGA
CGCCCTGTGCGGTTCCGGGGAGCTCGGCTCCAAGTTCTGGGACTCCAACCTGTCTGTGCA
CACAGAAAACCCGGACCTCACTCCCTGCTTCCAGAACTCCCTGCTGGCCTGGGTGCCCTG
CATCTACCTGTGGGTCGCCCTGCCCTGCTACTTGCTCTACCTGCGGCACCATTGTCGTGG
CTACATCATCCTCTCCCACCTGTCCAAGCTCAAGATGGTCCTGGGTGTCCTGCTGTGGTG
CGTCTCCTGGGCGGACCTTTTTTACTCCTTCCATGGCCTGATCCATGGCCGGGCCCCTGC
CCCTGTTTTCTTTGTCACCCCCTTGGTGGGTGGGGGTCACCATGCTGCTGGCCACCCTGC
TGATACAGTATGAGCGGCTGCAGGGCGTACAGTCTTCCGGGGTCCTCATTAACTTCTGGT
TCCCGTGTGTGGTCTGCCCCCATGTACCAATTCGGTTCAAGATCCTTTTTAGCCAAGGCA
GAGGGTGAAAATCTCAGACCCTTTTCCCCTTTACCCACCTTTAAATACAATTTGGCCCTG
GTACTCTTTTGCCCTCATCTTGGACCTGCTCCAGGGGAGAAACCTTCCTTTTTCCCCCCG
AAAAAATGTCTGCCCTATAACCCTACCCGGAAAACAAGCGCTTGGCTTTATCTTCCCCGC
TCGTTATTTTGGGTGGTTTCAAAAGAAGGGCCCATCTATGGGCTACCGGGCATTCCCCTG
GAGGAAGAAGGACCC
>OriGene 3' read for NM_003786 unedited
GTTCAACTTCCCGGCCAGGAGAGGCACTGGGGAGGGGTCACAGGGATGCCACCCGGGATC
TGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTT
TTTTTTTTTTTTACTGATGACCATGTAGTTTTATTTCATCAGTACTCCCATTTTTAATGG
ATTCAGGCAGCACCCCAGAGTACAGGACTGAGTTCCTAGGGGTGGCCTGACCCAGCAGCT
GTCTTCTGTTCCAGGAGGAAAAAGCTTTTTATTAAAAAACAGAAACGAAACTTTAGAAAA
TATGAAAAATCAGAGGGAGGACAGAGGTCATTTCATAAAATCGTTATTTGAAAACAGTGC
AGTGTGCAAATAACACTCAGTTGGGAATCGGGAGACCGGGGACTAGTCTAACTGGCTCAA
ACTAGCTGTGACCTTAGGCGTGTCATTCACCACTTGGGGATCATTTCCTCATCTAAAGCA
TTCAGCAAGATTACCCTGTAAAGCACTTTACAGGTGCAAAATCTTAAGGTGCCCCCAGTG
TTTGCTATCAAGTCCATTCTGCGGACATATTTGGTGTCATTTCCTTCCTGATGAAAACCA
GGAAAGGGCCAGGAGGAAATCTCAGGAATATATTTTAGGCAAGTCCAGCATCTCTGGCCA
TCCCGTAGAAGTATGCCTCTGCTGCCATGAAGGTGGCTGGAGAATCAAATTCACTTCTTA
CTCTTTGTCAGGAACAAGACCTGGTGAATCCATGAAAG
Tag Tag Free
ACCN NM_003786
ORF Size 4584 bp
Insert Size 5100
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_003786.2, NP_003777
RefSeq Size 5176
RefSeq ORF 4584
Locus ID 8714
Cytogenetics 17q21.33
Protein Families Transmembrane, Druggable Genome
Protein Pathways ABC transporters
Gene Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in the transport of biliary and intestinal excretion of organic anions. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)