MRP3 (ABCC3) (NM_003786) Human Untagged Clone

CAT#: SC125262

Reviews ()
Write a review

ABCC3 (untagged)-Human ATP-binding cassette, sub-family C (CFTR/MRP), member 3 (ABCC3), transcript variant 1



  "NM_003786" in other vectors (6)

Reconstitution Protocol

USD 1,307.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "ABCC3"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ABCC3
Synonyms ABC31; cMOAT2; EST90757; MLP2; MOAT-D; MRP3
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC125262 sequence for NM_003786 edited (data generated by NextGen Sequencing)
ATGGACGCCCTGTGCGGTTCCGGGGAGCTCGGCTCCAAGTTCTGGGACTCCAACCTGTCT
GTGCACACAGAAAACCCGGACCTCACTCCCTGCTTCCAGAACTCCCTGCTGGCCTGGGTG
CCCTGCATCTACCTGTGGGTCGCCCTGCCCTGCTACTTGCTCTACCTGCGGCACCATTGT
CGTGGCTACATCATCCTCTCCCACCTGTCCAAGCTCAAGATGGTCCTGGGTGTCCTGCTG
TGGTGCGTCTCCTGGGCGGACCTTTTTTACTCCTTCCATGGCCTGGTCCATGGCCGGGCC
CCTGCCCCTGTTTTCTTTGTCACCCCCTTGGTGGTGGGGGTCACCATGCTGCTGGCCACC
CTGCTGATACAGTATGAGCGGCTGCAGGGCGTACAGTCTTCGGGGGTCCTCATTATCTTC
TGGTTCCTGTGTGTGGTCTGCGCCATCGTCCCATTCCGCTCCAAGATCCTTTTAGCCAAG
GCAGAGGGTGAGATCTCAGACCCCTTCCGCTTCACCACCTTCTACATCCACTTTGCCCTG
GTACTCTCTGCCCTCATCTTGGCCTGCTTCAGGGAGAAACCTCCATTTTTCTCCGCAAAG
AATGTCGACCCTAACCCCTACCCTGAGACCAGCGCTGGCTTTCTCTCCCGCCTGTTTTTC
TGGTGGTTCACAAAGATGGCCATCTATGGCTACCGGCATCCCCTGGAGGAGAAGGACCTC
TGGTCCCTAAAGGAAGAGGACAGATCCCAGATGGTGGTGCAGCAGCTGCTGGAGGCATGG
AGGAAGCAGGAAAAGCAGACGGCACGACACAAGGCTTCAGCAGCACCTGGGAAAAATGCC
TCCGGCGAGGACGAGGTGCTGCTGGGTGCCCGGCCCAGGCCCCGGAAGCCCTCCTTCCTG
AAGGCCCTGCTGGCCACCTTCGGCTCCAGCTTCCTCATCAGTGCCTGCTTCAAGCTTATC
CAGGACCTGCTCTCCTTCATCAATCCACAGCTGCTCAGCATCCTGATCAGGTTTATCTCC
AACCCCATGGCCCCCTCCTGGTGGGGCTTCCTGGTGGCTGGGCTGATGTTCCTGTGCTCC
ATGATGCAGTCGCTGATCTTACAACACTATTACCACTACATCTTTGTGACTGGGGTGAAG
TTTCGTACTGGGATCATGGGTGTCATCTACAGGAAGGCTCTGGTTATCACCAACTCAGTC
AAACGTGCGTCCACTGTGGGGGAAATTGTCAACCTCATGTCAGTGGATGCCCAGCGCTTC
ATGGACCTTGCCCCCTTCCTCAATCTGCTGTGGTCAGCACCCCTGCAGATCATCCTGGCG
ATCTACTTCCTCTGGCAGAACCTAGGTCCCTCTGTCCTGGCTGGAGTCGCTTTCATGGTC
TTGCTGATTCCACTCAACGGAGCTGTGGCCGTGAAGATGCGCGCCTTCCAGGTAAAGCAA
ATGAAATTGAAGGACTCGCGCATCAAGCTGATGAGTGAGATCCTGAACGGCATCAAGGTG
CTGAAGCTGTACGCCTGGGAGCCCAGCTTCCTGAAGCAGGTGGAGGGCATCAGGCAGGGT
GAGCTCCAGCTGCTGCGCACGGCGGCCTACCTCCACACCACAACCACCTTCACCTGGATG
TGCAGCCCCTTCCTGGTGACCCTGATCACCCTCTGGGTGTACGTGTACGTGGACCCAAAC
AATGTGCTGGACGCCGAGAAGGCCTTTGTGTCTGTGTCCTTGTTTAATATCTTAAGACTT
CCCCTCAACATGCTGCCCCAGTTAATCAGCAACCTGACTCAGGCCAGTGTGTCTCTGAAA
CGGATCCAGCAATTCCTGAGCCAAGAGGAACTTGACCCCCAGAGTGTGGAAAGAAAGACC
ATCTCCCCAGGCTATGCCATCACCATACACAGTGGCACCTTCACCTGGGCCCAGGACCTG
CCCCCCACTCTGCACAGCCTAGACATCCAGGTCCCGAAAGGGGCACTGGTGGCCGTGGTG
GGGCCTGTGGGCTGTGGGAAGTCCTCCCTGGTGTCTGCCCTGCTGGGAGAGATGGAGAAG
CTAGAAGGCAAAGTGCACATGAAGGGCTCCGTGGCCTATGTGCCCCAGCAGGCATGGATC
CAGAACTGCACTCTTCAGGAAAACGTGCTTTTCGGCAAAGCCCTGAACCCCAAGCGCTAC
CAGCAGACTCTGGAGGCCTGTGCCTTGCTAGCTGACCTGGAGATGCTGCCTGGTGGGGAT
CAGACAGAGATTGGAGAGAAGGGCATTAACCTGTCTGGGGGCCAGCGGCAGCGGGTCAGT
CTGGCTCGAGCTGTTTACAGTGATGCCGATATTTTCTTGCTGGATGACCCACTGTCCGCG
GTGGACTCTCATGTGGCCAAGCACATCTTTGACCACGTCATCGGGCCAGAAGGCGTGCTG
GCAGGCAAGACGCGAGTGCTGGTGACGCACGGCATTAGCTTCCTGCCCCAGACAGACTTC
ATCATTGTGCTAGCTGATGGACAGGTGTCTGAGATGGGCCCGTACCCAGCCCTGCTGCAG
CGCAACGGCTCCTTTGCCAACTTTCTCTGCAACTATGCCCCCGATGAGGACCAAGGGCAC
CTGGAGGACAGCTGGACCGCGTTGGAAGGTGCAGAGGATAAGGAGGCACTGCTGATTGAA
GACACACTCAGCAACCACACGGATCTGACAGACAATGATCCAGTCACCTATGTGGTCCAG
AAGCAGTTTATGAGACAGCTGAGTGCCCTGTCCTCAGATGGGGAGGGACAGGGTCGGCCT
GTACCCCGGAGGCACCTGGGTCCATCAGAGAAGGTGCAGGTGACAGAGGCGAAGGCAGAT
GGGGCACTGACCCAGGAGGAGAAAGCAGCCATTGGCACTGTGGAGCTCAGTGTGTTCTGG
GATTATGCCAAGGCCGTGGGGCTCTGTACCACGCTGGCCATCTGTCTCCTGTATGTGGGT
CAAAGTGCGGCTGCCATTGGAGCCAATGTGTGGCTCAGTGCCTGGACAAATGATGCCATG
GCAGACAGTAGACAGAACAACACTTCCCTGAGGCTGGGCGTCTATGCTGCTTTAGGAATT
CTGCAAGGGTTCTTGGTGATGCTGGCAGCCATGGCCATGGCAGCGGGTGGCATCCAGGCT
GCCCGTGTGTTGCACCAGGCACTGCTGCACAACAAGATACGCTCGCCACAGTCCTTCTTT
GACACCACACCATCAGGCCGCATCCTGAACTGCTTCTCCAAGGACATCTATGTCGTTGAT
GAGGTTCTGGCCCCTGTCATCCTCATGCTGCTCAATTCCTTCTTCAACGCCATCTCCACT
CTTGTGGTCATCATGGCCAGCACGCCGCTCTTCACTGTGGTCATCCTGCCCCTGGCTGTG
CTCTACACCTTAGTGCAGCGCTTCTATGCAGCCACATCACGGCAACTGAAGCGGCTGGAA
TCAGTCAGCCGCTCACCTATCTACTCCCACTTTTCGGAGACAGTGACTGGTGCCAGTGTC
ATCCGGGCCTACAACCGCAGCCGGGATTTTGAGATCATCAGTGATACTAAGGTGGATGCC
AACCAGAGAAGCTGCTACCCCTACATCATCTCCAACCGGTGGCTGAGCATCGGAGTGGAG
TTCGTGGGGAACTGCGTGGTGCTCTTTGCTGCACTATTTGCCGTCATCGGGAGGAGCAGC
CTGAACCCGGGGCTGGTGGGCCTTTCTGTGTCCTACTCCTTGCAGGTGACATTTGCTCTG
AACTGGATGATACGAATGATGTCAGATTTGGAATCTAACATCGTGGCTGTGGAGAGGGTC
AAGGAGTACTCCAAGACAGAGACAGAGGCGCCCTGGGTGGTGGAAGGCAGCCGCCCTCCC
GAAGGTTGGCCCCCACGTGGGGAGGTGGAGTTCCGGAATTATTCTGTGCGCTACCGGCCG
GGCCTAGACCTGGTGCTGAGAGACCTGAGTCTGCATGTGCACGGTGGCGAGAAGGTGGGG
ATCGTGGGCCGCACTGGGGCTGGCAAGTCTTCCATGACCCTTTGCCTGTTCCGCATCCTG
GAGGCGGCAAAGGGTGAAATCCGCATTGATGGCCTCAATGTGGCAGACATCGGCCTCCAT
GACCTGCGCTCTCAGCTGACCATCATCCCGCAGGACCCCATCCTGTTCTCGGGGACCCTG
CGCATGAACCTGGACCCCTTCGGCAGCTACTCAGAGGAGGACATTTGGTGGGCTTTGGAG
CTGTCCCACCTGCACACGTTTGTGAGCTCCCAGCCGGCAGGCCTGGACTTCCAGTGCTCA
GAGGGCGGGGAGAATCTCAGCGTGGGCCAGAGGCAGCTCGTGTGCCTGGCCCGAGCCCTG
CTCCGCAAGAGCCGCATCCTGGTTTTAGACGAGGCCACAGCTGCCATCGACCTGGAGACT
GACAACCTCATCCAGGCTACCATCCGCACCCAGTTTGATACCTGCACTGTCCTGACCATC
GCACACCGGCTTAACACTATCATGGACTACACCAGGGTCCTGGTCCTGGACAAAGGAGTA
GTAGCTGAATTTGATTCTCCAGCCAACCTCATTGCAGCTAGAGGCATCTTCTACGGGATG
GCCAGAGATGCTGGACTTGCCTAA

Clone variation with respect to NM_003786.3
>OriGene 5' read for NM_003786 unedited
GGGGAAATCATTTACCCGCCCGTTGCCGCAATAGGGCGTAGGCGTGTACGGTGGGAGGTC
TATATAAGCAGAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGG
CGGCCGCGAATTCGGCACCAGGCGCTCGCCTTCCTTGCAGCCGCGCCTCGGCCCCATGGA
CGCCCTGTGCGGTTCCGGGGAGCTCGGCTCCAAGTTCTGGGACTCCAACCTGTCTGTGCA
CACAGAAAACCCGGACCTCACTCCCTGCTTCCAGAACTCCCTGCTGGCCTGGGTGCCCTG
CATCTACCTGTGGGTCGCCCTGCCCTGCTACTTGCTCTACCTGCGGCACCATTGTCGTGG
CTACATCATCCTCTCCCACCTGTCCAAGCTCAAGATGGTCCTGGGTGTCCTGCTGTGGTG
CGTCTCCTGGGCGGACCTTTTTTACTCCTTCCATGGCCTGATCCATGGCCGGGCCCCTGC
CCCTGTTTTCTTTGTCACCCCCTTGGTGGGTGGGGGTCACCATGCTGCTGGCCACCCTGC
TGATACAGTATGAGCGGCTGCAGGGCGTACAGTCTTCCGGGGTCCTCATTAACTTCTGGT
TCCCGTGTGTGGTCTGCCCCCATGTACCAATTCGGTTCAAGATCCTTTTTAGCCAAGGCA
GAGGGTGAAAATCTCAGACCCTTTTCCCCTTTACCCACCTTTAAATACAATTTGGCCCTG
GTACTCTTTTGCCCTCATCTTGGACCTGCTCCAGGGGAGAAACCTTCCTTTTTCCCCCCG
AAAAAATGTCTGCCCTATAACCCTACCCGGAAAACAAGCGCTTGGCTTTATCTTCCCCGC
TCGTTATTTTGGGTGGTTTCAAAAGAAGGGCCCATCTATGGGCTACCGGGCATTCCCCTG
GAGGAAGAAGGACCC
>OriGene 3' read for NM_003786 unedited
GTTCAACTTCCCGGCCAGGAGAGGCACTGGGGAGGGGTCACAGGGATGCCACCCGGGATC
TGTTCAGGAAACAGCTATGACCGCGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTT
TTTTTTTTTTTTACTGATGACCATGTAGTTTTATTTCATCAGTACTCCCATTTTTAATGG
ATTCAGGCAGCACCCCAGAGTACAGGACTGAGTTCCTAGGGGTGGCCTGACCCAGCAGCT
GTCTTCTGTTCCAGGAGGAAAAAGCTTTTTATTAAAAAACAGAAACGAAACTTTAGAAAA
TATGAAAAATCAGAGGGAGGACAGAGGTCATTTCATAAAATCGTTATTTGAAAACAGTGC
AGTGTGCAAATAACACTCAGTTGGGAATCGGGAGACCGGGGACTAGTCTAACTGGCTCAA
ACTAGCTGTGACCTTAGGCGTGTCATTCACCACTTGGGGATCATTTCCTCATCTAAAGCA
TTCAGCAAGATTACCCTGTAAAGCACTTTACAGGTGCAAAATCTTAAGGTGCCCCCAGTG
TTTGCTATCAAGTCCATTCTGCGGACATATTTGGTGTCATTTCCTTCCTGATGAAAACCA
GGAAAGGGCCAGGAGGAAATCTCAGGAATATATTTTAGGCAAGTCCAGCATCTCTGGCCA
TCCCGTAGAAGTATGCCTCTGCTGCCATGAAGGTGGCTGGAGAATCAAATTCACTTCTTA
CTCTTTGTCAGGAACAAGACCTGGTGAATCCATGAAAG
Restriction Sites Please inquire     
ACCN NM_003786
Insert Size 5100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_003786.2, NP_003777.2
RefSeq Size 5176 bp
RefSeq ORF 4584 bp
Locus ID 8714
UniProt ID O15438
Cytogenetics 17q21.33
Protein Families Druggable Genome, Transmembrane
Protein Pathways ABC transporters
Gene Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in the transport of biliary and intestinal excretion of organic anions. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (1).

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.