Ribonuclease A (RNASE1) (NM_198235) Human Untagged Clone

CAT#: SC124287

RNASE1 (untagged)-Human ribonuclease, RNase A family, 1 (pancreatic) (RNASE1), transcript variant 1


  "NM_198235" in other vectors (4)

Reconstitution Protocol

USD 150.00

In Stock*

Size
    • 10 ug

Product Images

Frequently bought together (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 507.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 160.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 59.00


RNASE1 rabbit polyclonal antibody
    • 100 ul

USD 380.00

Other products for "Ribonuclease A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol Ribonuclease A
Synonyms RAC1; RIB1; RNS1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_198235, the custom clone sequence may differ by one or more nucleotides


ATGGCTCTGGAGAAGTCTCTTGTCCGGCTCCTTCTGCTTGTCCTGATACTGCTGGTGCTGGGCTGGGTCC
AGCCTTCCCTGGGCAAGGAATCCCGGGCCAAGAAATTCCAGCGGCAGCATATGGACTCAGACAGTTCCCC
CAGCAGCAGCTCCACCTACTGTAACCAAATGATGAGGCGCCGGAATATGACACAGGGGCGGTGCAAACCA
GTGAACACCTTTGTGCACGAGCCCCTGGTAGATGTCCAGAATGTCTGTTTCCAGGAAAAGGTCACCTGCA
AGAACGGGCAGGGCAACTGCTACAAGAGCAACTCCAGCATGCACATCACAGACTGCCGCCTGACAAACGG
CTCCAGGTACCCCAACTGTGCATACCGGACCAGCCCGAAGGAGAGACACATCATTGTGGCCTGTGAAGGG
AGCCCATATGTGCCAGTCCACTTTGATGCTTCTGTGGAGGACTCTACCTAA


>OriGene 5' read for NM_198235 unedited
GCACGAGGCTTCCATCTCTCTCAGACACCAAGCTGCAGATCCAGGCTTTTCTGGGAAAGT
GAGGCCACCATGGCTCTGGAGAAGTCTCTTGTCCGGCTCCTTCTGCTTGTCCTGATACTG
CTGGTGCTGGGCTGGGTCCAGCCTTCCCTGGGCAAGGAATCCCGGGCCAAGAAATTCCAG
CGGCAGCATATGGACTCAGACAGTTCCCCCAGCAGCAGCTCCACCTACTGTAACCAAATG
ATGAGGCGCCGGAATATGACACAGGGGCGGTGCAAACCAGTGAACACCTTTGTGCACGAG
CCCCTGGTAGATGTCCAGAATGTCTGTTTCCAGGAAAAGGTCACCTGCAAGAACGGGCAG
GGCAACTGCTACAAGAGCAACTCCAGCATGCACATCACAGACTGCCGCCTGACAAACGGC
TCCAGGTACCCCAACTGTGCATACCGGACCAGCCCGAAGGAGAGACACATCATTGTGGCC
TGTGAAGGGAGCCCATATGTGCCAGTCCACTTTGATGCTTCTGTGGAGGACTCTACCTAA
GGTCAGAGCAGCGAGATACCCCACCTCCCTCAACCTCATCCTCTCCACAGCTGCCTCTTC
CCTCTTCCTTCCCTGCTGTGAAAGAAGTAACTACAGTTAGGGCTCCTATTCAACACACAC
ATGCTTCCCTTTCCTGAGTCCCATCCCTGCGT
Restriction Sites NotI-NotI     
ACCN NM_198235
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_198235.1, NP_937878.1
RefSeq Size 907 bp
RefSeq ORF 471 bp
Locus ID 6035
UniProt ID P07998
Cytogenetics 14q11.2
Protein Families Secreted Protein, Transmembrane
Gene Summary This gene encodes a member of the pancreatic-type of secretory ribonucleases, a subset of the ribonuclease A superfamily. The encoded endonuclease cleaves internal phosphodiester RNA bonds on the 3'-side of pyrimidine bases. It prefers poly(C) as a substrate and hydrolyzes 2',3'-cyclic nucleotides, with a pH optimum near 8.0. The encoded protein is monomeric and more commonly acts to degrade ds-RNA over ss-RNA. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) contains an additional segment in the 5' UTR compared to variant 4. Variants 1, 2, 3 and 4 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.