TRPA1 (NM_007332) Human Untagged Clone

CAT#: SC124028

Reviews ()
Write a review

TRPA1 (untagged)-Human transient receptor potential cation channel, subfamily A, member 1 (TRPA1)



  "NM_007332" in other vectors (6)

Reconstitution Protocol

USD 2,180.00


Availability*
In Stock

Size
    • 10 ug


Product images

Other products for "TRPA1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TRPA1
Synonyms ANKTM1; FEPS; FEPS1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_007332 edited
ATGAAGCGCAGCCTGAGGAAGATGTGGCGCCCTGGAGAAAAGAAGGAGCCCCAGGGCGTT
GTCTATGAGGATGTGCCGGACGACACGGAGGATTTCAAGGAATCGCTTAAGGTGGTTTTT
GAAGGAAGTGCATATGGATTACAAAACTTTAATAAGCAAAAGAAATTAAAAAGATGTGAC
GATATGGACACCTTCTTCTTGCATTATGCTGCAGCAGAAGGCCAAATTGAGCTAATGGAG
AAGATCACCAGAGATTCCTCTTTGGAAGTGCTGCATGAAATGGATGATTATGGAAATACC
CCTCTGCATTGTGCTGTAGAAAAAAACCAAATTGAAAGCGTTAAGTTTCTTCTCAGCAGA
GGAGCAAACCCAAACCTCCGAAACTTCAACATGATGGCTCCTCTCCACATAGCTGTGCAG
GGCATGAATAATGAGGTGATGAAGGTCTTGCTTGAGCATAGAACTATTGATGTTAATTTG
GAAGGAGAAAATGGAAACACAGCTGTGATCATTGCGTGCACCACAAATAATAGCGAAGCA
TTGCAGATTTTGCTTAACAAAGGAGCTAAGCCATGTAAATCAAATAAATGGGGATGTTTC
CCTATTCACCAAGCTGCATTTTCAGGTTCCAAAGAATGCATGGAAATAATACTAAGGTTT
GGTGAAGAGCATGGGTACAGTAGACAGTTGCACATTAACTTTATGAATAATGGGAAAGCC
ACCCCTCTCCACCTGGCTGTGCAAAATGGTGACTTGGAAATGATCAAAATGTGCCTGGAC
AATGGTGCACAAATAGACCCAGTGGAGAAGGGAAGGTGCACAGCCATTCATTTTGCTGCC
ACCCAGGGAGCCACTGAGATTGTTAAACTGATGATATCGTCCTATTCTGGTAGCGTGGAT
ATTGTTAACACAACCGATGGATGTCATGAGACCATGCTTCACAGAGCTTCATTGTTTGAT
CACCATGAGCTAGCAGACTATTTAATTTCAGTGGGAGCAGATATTAATAAGATCGATTCT
GAAGGACGCTCTCCACTTATATTAGCAACTGCTTCTGCATCTTGGAATATTGTAAATTTG
CTACTCTCTAAAGGTGCCCAAGTAGACATAAAAGATAATTTTGGACGTAATTTTCTGCAT
TTAACTGTACAGCAACCTTATGGATTAAAAAATCTGCGACCTGAATTTATGCAGATGCAA
CAGATCAAAGAGCTGGTAATGGATGAAGACAACGATGGGTGTACTCCTCTACATTATGCA
TGTAGACAGGGGGGCCCTGGTTCTGTAAATAACCTACTTGGCTTTAATGTGTCCATTCAT
TCCAAAAGCAAAGATAAGAAATCACCTCTGCATTTTGCAGCCAGTTATGGGCGTATCAAT
ACCTGTCAGAGGCTCCTACAAGACATAAGTGATACGAGGCTTCTGAATGAAGGTGACCTT
CATGGAATGACTCCTCTCCATCTGGCAGCAAAGAATGGACATGATAAAGTAGTTCAGCTT
CTTCTGAAAAAAGGTGCATTGTTTCTCAGTGACCACAATGGCTGGACAGCTTTGCATCAT
GCGTCCATGGGCGGGTACACTCAGACCATGAAGGTCATTCTTGATACTAATTTGAAGTGC
ACAGATCGCTTGGATGAAGACGGGAACACTGCACTTCACTTTGCTGCAAGGGAAGGCCAT
GCCAAAGCCGTTGCGCTTCTTCTGAGCCACAATGCTGACATAGTCCTGAACAAGCAGCAG
GCCTCCTTTTTGCACCTTGCACTTCACAATAAGAGGAAGGAGGTTGTTCTTACGATCATC
AGGAGCAAAAGATGGGATGAATGTCTTAAGATTTTCAGTCATAATTCTCCAGGCAATAAA
TGTCCAATTACAGAAATGATAGAATACCTCCCTGAATGCATGAAGGTACTTTTAGATTTC
TGCATGTTGCATTCCACAGAAGACAAGTCCTGCCGAGACTATTATATCGAGTATAATTTC
AAATATCTTCAATGTCCATTAGAATTCACCAAAAAAACACCTACACAGGATGTTATATAT
GAACCGCTTACAGCCCTCAACGCAATGGTACAAAATAACCGCATAGAGCTTCTCAATCAT
CCTGTGTGTAAAGAATATTTACTCATGAAATGGTTGGCTTATGGATTTAGAGCTCATATG
ATGAATTTAGGATCTTACTGTCTTGGTCTCATACCTATGACCATTCTCGTTGTCAATATA
AAACCAGGAATGGCTTTCAACTCAACTGGCATCATCAATGAAACTAGTGATCATTCAGAA
ATACTAGATACCACGAATTCATATCTAATAAAAACTTGTATGATTTTAGTGTTTTTATCA
AGTATATTTGGGTATTGCAAAGAAGCGGGGCAAATTTTCCAACAGAAAAGGAATTATTTT
ATGGATATAAGCAATGTTCTTGAATGGATTATCTACACGACGGGCATCATTTTTGTGCTG
CCCTTGTTTGTTGAAATACCAGCTCATCTGCAGTGGCAATGTGGAGCAATTGCTGTTTAC
TTCTATTGGATGAATTTCTTATTGTATCTTCAAAGATTTGAAAATTGTGGAATTTTTATT
GTTATGTTGGAGGTAATTTTGAAAACTTTGTTGAGGTCTACAGTTGTATTTATCTTCCTT
CTTCTGGCTTTTGGACTCAGCTTTTACATCCTCCTGAATTTACAGGATCCCTTCAGCTCT
CCATTGCTTTCTATAATCCAGACCTTCAGCATGATGCTAGGAGATATCAATTATCGAGAG
TCCTTCCTAGAACCATATCTGAGAAATGAATTGGCACATCCAGTTCTGTCCTTTGCACAA
CTTGTTTCCTTCACAATATTTGTCCCAATTGTCCTCATGAATTTACTTATTGGTTTGGCA
GTTGGCGACATTGCTGAGGTCCAGAAACATGCATCATTGAAGAGGATAGCTATGCAGGTG
GAACTTCATACCAGCTTAGAGAAGAAGCTGCCACTTTGGTTTCTACGCAAAGTGGATCAG
AAATCCACCATCGTGTATCCCAACAAACCCAGATCTGGTGGGATGTTATTCCATATATTC
TGTTTTTTATTTTGCACTGGGGAAATAAGACAAGAAATACCAAATGCTGATAAATCTTTA
GAAATGGAAATATTAAAGCAGAAATACCGGCTGAAGGATCTTACTTTTCTCCTGGAAAAA
CAGCATGAGCTCATTAAACTGATCATTCAGAAGATGGAGATCATCTCTGAGACAGAGGAT
GATGATAGCCATTGTTCTTTTCAAGACAGGTTTAAGAAAGAGCAGATGGAACAAAGGAAT
AGCAGATGGAATACTGTGTTGAGAGCAGTCAAGGCAAAAACACACCATCTTGAGCCTTAG
>OriGene 5' read for NM_007332 unedited
NNNGGGGGGTTCGACAATATTTGTNAATACGNATTCACTATAGGGCCGGCCGCGNAATTC
GCACGAGGAAGGTGCCCGCGCGCGTGGTGAGCAGCTGCACCAGGTGGCGTCCGGGGTGGG
GTCAATGAAGCGCAGCCTGAGGAAGATGTGGCGCCCTGGAGAAAAGAAGGAGCCCCAGGG
CGTTGTCTATGAGGATGTGCCGGACGACACGGAGGATTTCAAGGAATCGCTTAAGGTGGT
TTTTGAAGGAAGTGCATATGGATTACAAAACTTTAATAAGCAAAAGAAATTAAAAAGATG
TGACGATATGGACACCTTCTTCTTGCATTATGCTGCAGCAGAAGGCCAAATTGAGCTAAT
GGAGAAGATCACCAGAGATTCCTCTTTGGAAGTGCTGCATGAAATGGATGATTATGGAAA
TACCCCTCTGCATTGTGCTGTAGAAAAAAACCAAATTGAAAGCGTTAAGTTTCTTCTCAG
CAGAGGAGCAAACCCAAACCTCCGAAACTTCAACATGATGGCTCCTCTCCACATAGCTGT
GCAGGGCATGATATAATGAGGTGATGAAGGTCTTGCTTGAGCATAGAACTATTGATGTTA
ATTTGGAAGGAGAAAATGGAAACACAGCTGTGATCATTGCGTGCACCACANATAATAGCG
AAGCATTGCAGATTTTGCTTAACANAGGAGCTAAGCCATGTAAATCAAATAAATGGGGAT
TGTTTCCCTATTCACCAAGCTGCATTTTCAGGTTCAAAGAATGCATGGAAATAATACTAA
GGTTTGGTGAAGAGCATGGGTTCAGTATACAGTTGCACATTAACTTTATGAATAATGGGA
AAGCCACCCCTTTCCACTGGCAGTGCCAAATGTGGACTTGGA
>Forward primer walk for NM_007332 unedited
GAAACATGCATCATTGAAGAGGATAGCTATGCAGGTGGAACTTCATACCAGCTTAGAGAA
GAAGCTGCCACTTTGGTTTCTACGCAAAGTGGATCAGAAATCCACCATCGTGTATCCCAA
CAAACCCAGATCTGGTGGGATGTTATTCCATATATTCTGTTTTTTATTTTGCACTGGGGA
AATAAGACAAGAAATACCAAATGCTGATAAATCTTTAGAAATGGAAATATTAAAGCAGAA
ATACCGGCTGAAGGATCTTACTTTTCTCCTGGAAAAACAGCATGAGCTCATTAAACTGAT
CATTCAGAAGATGGAGATCATCTCTGAGACAGAGGATGATGATAGCCATTGTTCTTTTCA
AGACAGGTTTAAGAAAGAGCAGATGGAACAAAGGAATAGCAGATGGAATACTGTGTTGAG
AGCAGTCAAGGCAAAAACACACCATCTTGAGCCTTAGCTCCTCAGACCTTCAGTGAGGCT
TCTAATGGGGGGTGCATGACTTGCTGGTTCTAACTTTCAATTTAAAAAGAGTGAGGAAGA
AGCAGAATGATTCATTTTGCTGCGTGTGAAATCATGGTTCCTGCATGCTGTATAAAAGTA
AACCATCTTTTATCCTCTATTCATATTTTCTACCAATCACTATGTATTGGGGATATCTTT
GCAGATATGTTCAAATTGGACTGGACTTTGATGAGATATAATCTCATTATTTGAATGGGT
AGAAAATGAATTTTGCTAGACACN
Restriction Sites NotI-NotI     
ACCN NM_007332
Insert Size 4000 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to contain 1 SNPs compared with NM_007332.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_007332.1, NP_015628.1
RefSeq Size 5190 bp
RefSeq ORF 5190 bp
Locus ID 8989
UniProt ID O75762
Cytogenetics 8q21.11
Protein Families Druggable Genome, Ion Channels: Transient receptor potential, Transmembrane
Gene Summary The structure of the protein encoded by this gene is highly related to both the protein ankyrin and transmembrane proteins. The specific function of this protein has not yet been determined; however, studies indicate the function may involve a role in signal transduction and growth control. [provided by RefSeq, Jul 2008]

Other Versions

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.