RUNX1 (NM_001754) Human Untagged Clone

SKU
SC123977
RUNX1 (untagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 1
$686.00
In Stock*
Specifications
Product Data
Type Human Untagged Clone
Target Symbol RUNX1
Synonyms AML1; AML1-EVI-1; AMLCR1; CBF2alpha; CBFA2; EVI-1; PEBP2aB; PEBP2alpha
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC123977 sequence for NM_001754 edited (data generated by NextGen Sequencing)
ATGGCTTCAGACAGCATATTTGAGTCATTTCCTTCGTACCCACAGTGCTTCATGAGAGAA
TGCATACTTGGAATGAATCCTTCTAGAGACGTCCACGATGCCAGCACGAGCCGCCGCTTC
ACGCCGCCTTCCACCGCGCTGAGCCCAGGCAAGATGAGCGAGGCGTTGCCGCTGGGCGCC
CCGGACGCCGGCGCTGCCCTGGCCGGCAAGCTGAGGAGCGGCGACCGCAGCATGGTGGAG
GTGCTGGCCGACCACCCGGGCGAGCTGGTGCGCACCGACAGCCCCAACTTCCTCTGCTCC
GTGCTGCCTACGCACTGGCGCTGCAACAAGACCCTGCCCATCGCTTTCAAGGTGGTGGCC
CTAGGGGATGTTCCAGATGGCACTCTGGTCACTGTGATGGCTGGCAATGATGAAAACTAC
TCGGCTGAGCTGAGAAATGCTACCGCAGCCATGAAGAACCAGGTTGCAAGATTTAATGAC
CTCAGGTTTGTCGGTCGAAGTGGAAGAGGGAAAAGCTTCACTCTGACCATCACTGTCTTC
ACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCC
CGAGAACCTCGAAGACATCGGCAGAAACTAGATGATCAGACCAAGCCCGGGAGCTTGTCC
TTTTCCGAGCGGCTCAGTGAACTGGAGCAGCTGCGGCGCACAGCCATGAGGGTCAGCCCA
CACCACCCAGCCCCCACGCCCAACCCTCGTGCCTCCCTGAACCACTCCACTGCCTTTAAC
CCTCAGCCTCAGAGTCAGATGCAGGATACAAGGCAGATCCAACCATCCCCACCGTGGTCC
TACGATCAGTCCTACCAATACCTGGGATCCATTGCCTCTCCTTCTGTGCACCCAGCAACG
CCCATTTCACCTGGACGTGCCAGCGGCATGACAACCCTCTCTGCAGAACTTTCCAGTCGA
CTCTCAACGGCACCCGACCTGACAGCGTTCAGCGACCCGCGCCAGTTCCCCGCGCTGCCC
TCCATCTCCGACCCCCGCATGCACTATCCAGGCGCCTTCACCTACTCCCCGACGCCGGTC
ACCTCGGGCATCGGCATCGGCATGTCGGCCATGGGCTCGGCCACGCGCTACCACACCTAC
CTGCCGCCGCCCTACCCCGGCTCGTCGCAAGCGCAGGGAGGCCCGTTCCAAGCCAGCTCG
CCCTCCTACCACCTGTACTACGGCGCCTCGGCCGGCTCCTACCAGTTCTCCATGGTGGGC
GGCGAGCGCTCGCCGCCGCGCATCCTGCCGCCCTGCACCAACGCCTCCACCGGCTCCGCG
CTGCTCAACCCCAGCCTCCCGAACCAGAGCGACGTGGTGGAGGCCGAGGGCAGCCACAGC
AACTCCCCCACCAACATGGCGCCCTCCGCGCGCCTGGAGGAGGCCGTGTGGAGGCCCTAC
TGA

Clone variation with respect to NM_001754.4
Restriction Sites Please inquire
ACCN NM_001754
Insert Size 2100 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution Method 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001754.3, NP_001745.2
RefSeq Size 6190 bp
RefSeq ORF 1443 bp
Locus ID 861
UniProt ID Q01196
Cytogenetics 21q22.12
Domains Runt
Protein Families Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors
Protein Pathways Acute myeloid leukemia, Chronic myeloid leukemia, Pathways in cancer
Summary Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest isoform (AML1c). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
Write Your Own Review
You're reviewing:RUNX1 (NM_001754) Human Untagged Clone
Your Rating
SKU Description Size Price
RC223809 RUNX1 (Myc-DDK-tagged)-Human runt-related transcription factor 1 (RUNX1), transcript variant 1 10 ug
$686.00
RC223809L1 Lenti ORF clone of Human runt-related transcription factor 1 (RUNX1), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC223809L2 Lenti ORF clone of Human runt-related transcription factor 1 (RUNX1), transcript variant 1, mGFP tagged 10 ug
$986.00
RC223809L3 Lenti ORF clone of Human runt-related transcription factor 1 (RUNX1), transcript variant 1, Myc-DDK-tagged 10 ug
$986.00
RC223809L4 Lenti ORF clone of Human runt-related transcription factor 1 (RUNX1), transcript variant 1, mGFP tagged 10 ug
$986.00
RG223809 RUNX1 (tGFP-tagged) - Human runt-related transcription factor 1 (RUNX1), transcript variant 1 10 ug
$886.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.