Smoothened(SMO) (NM_005631) Human Untagged Clone

CAT#: SC122724

SMO (untagged)-Human smoothened, frizzled family receptor (SMO)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Smoothened(SMO) (NM_005631) Human Untagged Clone
Symbol SMO
Synonyms FZD11; Gx; SMOH
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_005631 edited
GGGCTGAAGACAACTTGGATTGCGAGGCTAGGGCTTGGGGAGTCGTGCATCCCGTTCCGG
GCCTCCGCAGCCCAACATGGGCCCCGGGTTCCAAAGTTTGCGAAGTTGGGCGCCGAGGGG
CCGGGGCGCGCGGAGCGTCCGGGGGGGCCCGGGCCCGGATTCTCTGGGCGCACAGGTCGC
CTGAGCCGCCTCCGCGGCCGCCGAGGTCGTGCGTGTGGCCGGGGGGCTCCGAGGAGCAGG
CGGGGGCGCCGGGGCTTTTGCTGAGTTGGCGGGGTTGGCCATGGCCGCTGCCCGCCCAGC
GCGGGGGCCGGAGCTCCCGCTCCTGGGGCTGCTGCTGCTGCTGCTGCTGGGGGACCCGGG
CCGGGGGGCGGCCTCGAGCGGGAACGCGACCGGGCCTGGGCCTCGGAGCGCGGGCGGGAG
CGCGAGGAGGAGCGCGGCGGTGACTGGCCCTCCGCCGCCGCTGAGCCACTGCGGCCGGGC
TGCCCCCTGCGAGCCGCTGCGCTACAACGTGTGCCTGGGCTCGGTGCTGCCCTACGGGGC
CACCTCCACACTGCTGGCCGGAGACTCGGACTCCCAGGAGGAAGCGCACGGCAAGCTCGT
GCTCTGGTCGGGCCTCCGGAATGCCCCCCGCTGCTGGGCAGTGATCCAGCCCCTGCTGTG
TGCCGTATACATGCCCAAGTGTGAGAATGACCGGGTGGAGCTGCCCAGCCGTACCCTCTG
CCAGGCCACCCGAGGCCCCTGTGCCATCGTGGAGAGGGAGCGGGGCTGGCCTGACTTCCT
GCGCTGCACTCCTGACCGCTTCCCTGAAGGCTGCACGAATGAGGTGCAGAACATCAAGTT
CAACAGTTCAGGCCAGTGCGAAGTGCCCTTGGTTCGGACAGACAACCCCAAGAGCTGGTA
CGAGGACGTGGAGGGCTGCGGCATCCAGTGCCAGAACCCGCTCTTCACAGAGGCTGAGCA
CCAGGACATGCACAGCTACATCGCGGCCTTCGGGGCCGTCACGGGCCTCTGCACGCTCTT
CACCCTGGCCACATTCGTGGCTGACTGGCGGAACTCGAATCGCTACCCTGCTGTTATTCT
CTTCTACGTCAATGCGTGCTTCTTTGTGGGCAGCATTGGCTGGCTGGCCCAGTTCATGGA
TGGTGCCCGCCGAGAGATCGTCTGCCGTGCAGATGGCACCATGAGGCTTGGGGAGCCCAC
CTCCAATGAGACTCTGTCCTGCGTCATCATCTTTGTCATCGTGTACTACGCCCTGATGGC
TGGTGTGGTTTGGTTTGTGGTCCTCACCTATGCCTGGCACACTTCCTTCAAAGCCCTGGG
CACCACCTACCAGCCTCTCTCGGGCAAGACCTCCTACTTCCACCTGCTCACCTGGTCACT
CCCCTTTGTCCTCACTGTGGCAATCCTTGCTGTGGCGCAGGTGGATGGGGACTCTGTGAG
TGGCATTTGTTTTGTGGGCTACAAGAACTACCGATACCGTGCGGGCTTCGTGCTGGCCCC
AATCGGCCTGGTGCTCATCGTGGGAGGCTACTTCCTCATCCGAGGAGTCATGACTCTGTT
CTCCATCAAGAGCAACCACCCCGGGCTGCTGAGTGAGAAGGCTGCCAGCAAGATCAACGA
GACCATGCTGCGCCTGGGCATTTTTGGCTTCCTGGCCTTTGGCTTTGTGCTCATTACCTT
CAGCTGCCACTTCTACGACTTCTTCAACCAGGCTGAGTGGGAGCGCAGCTTCCGGGACTA
TGTGCTATGTCAGGCCAATGTGACCATCGGGCTGCCCACCAAGCAGCCCATCCCTGACTG
TGAGATCAAGAATCGCCCGAGCCTTCTGGTGGAGAAGATCAACCTGTTTGCCATGTTTGG
AACTGGCATCGCCATGAGCACCTGGGTCTGGACCAAGGCCACGCTGCTCATCTGGAGGCG
TACCTGGTGCAGGTTGACTGGGCAGAGTGACGATGAGCCAAAGCGGATCAAGAAGAGCAA
GATGATTGCCAAGGCCTTCTCTAAGCGGCACGAGCTCCTGCAGAACCCAGGCCAGGAGCT
GTCCTTCAGCATGCACACTGTGTCCCACGACGGGCCCGTGGCGGGCTTGGCCTTTGACCT
CAATGAGCCCTCAGCTGATGTCTCCTCTGCCTGGGCCCAGCATGTCACCAAGATGGTGGC
TCGGAGAGGAGCCATACTGCCCCAGGATATTTCTGTCACCCCTGTGGCAACTCCAGTGCC
CCCAGAGGAACAAGCCAACCTGTGGCTGGTTGAGGCAGAGATCTCCCCAGAGCTGCAGAA
GCGCCTGGGCCGGAAGAAGAAGAGGAGGAAGAGGAAGAAGGAGGTGTGCCCGCTGGCGCC
GCCCCCTGAGCTTCACCCCCCTGCCCCTGCCCCCAGTACCATTCCTCGACTGCCTCAGCT
GCCCCGGCAGAAATGCCTGGTGGCTGCAGGTGCCTGGGGAGCTGGGGACTCTTGCCGACA
GGGAGCGTGGACCCTGGTCTCCAACCCATTCTGCCCAGAGCCCAGTCCCCCTCAGGATCC
ATTTCTGCCCAGTGCACCGGCCCCCGTGGCATGGGCTCATGGCCGCCGACAGGGCCTGGG
GCCTATTCACTCCCGCACCAACCTGATGGACACAGAACTCATGGATGCAGACTCGGACTT
CTGAGCCTGCAGAGCAGGACCTGGGACAGGAAAGAGAGGAACCAATACCTTCAAGGCTCT
TCTTCCTCACCGAGCATGCTTCCCTAGGATCCCGTCTTCCAGAGAACCTGTGGGCTGACT
GCCCTCCGAAGAGAGTTCTGGATGTCTGGCTCAAAGCAGCAGGACTGTGGGAAAGAGCCT
AACATCTCCATGGGGAGGCCTCACCCCAGGGACAGGGCCCTGGAGCTCAGGGTCCTTGTT
TCTGCCCTGCCAGCTGCAGCCTGGTTGGCAGCATCTGCTCCATCGGGGCAGGGGGTATGC
AGAGCTTGTGGTGGGGCAGGAACGGTGGAGGCAGAGGTGACAGTTCCCAGAGTGGGCTTT
GGTGGCCAGGGAGGCAGCCTAGCCTATGTCTGGCAGATGAGGGCTGGCTGCCGTTTTCTG
GGCTGATGGGTGCCCTTTCCTGGCAGTCTCAGTCCAAAAGTGTTGACTGTGTCATTAGTC
CTTTGTCTAAGTAGGGCCAGGGCACCGTATTCCTCTCCCAGGTGTTTGTGGGGCTGGAAG
GACCTGCTCCCACAGGGGCCATGTCCTCTCTTAATAGGTGGCACTACCCCAAACCCATCT
TTTGTTCTCCTATATCCTCCTTCTCCTGTTCCATTTCAGTTCAGTTTCAGCGGTGCCAAC
CTCTTTGCGTTTCCTTTTTGTTGATGAGGACCCAGAGCTGCTGCACACACTCACCTCTAA
CCCCCTCCCCTCGCTGCTGGGCCCCATCTCCACAGGAGAGACTGGTTCGGCTCTAGGGCC
TCAGTCTGGAGTGGGATAGGAGCAGTGAGTGACAAAGCCTCTGAAAGATGCATCATCTCT
TCCTCACACCCATTTAGTGGGGGATGGGTCCTCTAGACTTGAGGGGCTACCCTGGGAAGC
TGCCGTAGCTTCAGCCAGGCAAGAAAGCTTCCTTCAACCTGCATAGCCGGTGGGTGAGGA
GATTCCCACCTTCCATAGCCTCCAAACATGTTCCCAAGGCCCCACTTTCAAGAATCAGAC
AGCAGGAAGCCATAGATGCTGGCTGGGTTCCAGGTTATGGGGAGAAGAAATACAGTCAAT
AAAAGGTTTTTGTATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
5' Read Nucleotide Sequence
>OriGene 5' read for NM_005631 unedited
NNNNAAATGGCAACATTTGTATACGACTCATATAGGGCGGCCGCGAATTCGCACGAGGAG
GGCTGAAGACAACTTGGATTGCGAGGCTAGGGCTTGGGGAGTCGTGCATCCCGTTCCGGG
CCTCCGCAGCCCAACATGGGCCCCGGGTTCCAAAGTTTGCGAAGTTGGGCGCCGAGGGGC
CGGGGCGCGCGGAGCGTCCGGGGGGGCCCGGGCCCGGATTCTCTGGGCGCACAGGTCGCC
TGAGCCGCCTCCGCGGCCGCCGAGGTCGTGCGTGTGGCCGGGGGGCTCCGAGGAGCAGGC
GGGGGCGCCGGGGCTTTTGCTGAGTTGGCGGGGTTGGCCATGGCCGCTGCCCGCCCAGCG
CGGGGGCCGGAGCTCCCGCTCCTGGGGCTGCTGCTGCTGCTGCTGCTGGGGGACCCGGGC
CGGGGGGCGGCCTCGAGCGGGAACGCGACCGGGCCTGGGCCTCGGAGCGCGGGCGGGAGC
GCGAGGAGGAGCGCGGCGGTGACTGGCCCTCCGCCGCCGCTGAGCCACTGCGGCCGGGCT
GCCCCCTGCGAGCCGCTGCGCTACAACGTGTGCCTGGGCTCGGTGCTGCCCTACGGTGCC
ACCTCCACACTGCTGGCCGGAGACTCGGACTCCCAGGAGGAAGCGCACGGCAAGCTCGTG
CTCTGGTCGGGCCTCCGGAATGCCCCCCGCTGCTGGGCAGTGATCCAGCCCCTGCTGTGT
GCCGTATACATGCCCAAGTGTGAGAATGACCGGGTGGAGCTGCCCAGCCGTACCCTCTGC
CATGCCACCCGATGCCCCTGTGCCATCNTGGAAAGGGAGCGGGGCTGGCCTGACTTCCTG
CGCTGCACTCCTGACCGCTTCCCG
Tag Tag Free
ACCN NM_005631
ORF Size 2364 bp
Insert Size 3800
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005631.3, NP_005622
RefSeq Size 3772
Locus ID 6608
Cytogenetics 7q32.1
Protein Families Stem cell relevant signaling - DSL/Notch pathway, ES Cell Differentiation/IPS, Transmembrane, Druggable Genome
Protein Pathways Hedgehog signaling pathway, Pathways in cancer, Basal cell carcinoma
Gene Summary The protein encoded by this gene is a G protein-coupled receptor that interacts with the patched protein, a receptor for hedgehog proteins. The encoded protein tranduces signals to other proteins after activation by a hedgehog protein/patched protein complex. [provided by RefSeq, Jul 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations