MRP4(ABCC4) (NM_005845) Human Untagged Clone

CAT#: SC121947

ABCC4 (untagged)-Human ATP-binding cassette, sub-family C (CFTR/MRP), member 4 (ABCC4), transcript variant 1

USD 2,534


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MRP4(ABCC4) (NM_005845) Human Untagged Clone
Symbol ABCC4
Synonyms MOAT-B; MOATB; MRP4
Vector pCMV6-Neo
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC121947 sequence for NM_005845 edited (data generated by NextGen Sequencing)
ATGCTGCCCGTGTACCAGGAGGTGAAGCCCAACCCGCTGCAGGACGCGAACCTCTGCTCA
CGCGTGTTCTTCTGGTGGCTCAATCCCTTGTTTAAAATTGGCCATAAACGGAGATTAGAG
GAAGATGATATGTATTCAGTGCTGCCAGAAGACCGCTCACAGCACCTTGGAGAGGAGTTG
CAAGGGTTCTGGGATAAAGAAGTTTTAAGAGCTGAGAATGACGCACAGAAGCCTTCTTTA
ACAAGAGCAATCATAAAGTGTTACTGGAAATCTTATTTAGTTTTGGGAATTTTTACGTTA
ATTGAGGAAAGTGCCAAAGTAATCCAGCCCATATTTTTGGGAAAAATTATTAATTATTTT
GAAAATTATGATCCCATGGATTCTGTGGCTTTGAACACAGCGTACGCCTATGCCACGGTG
CTGACTTTTTGCACGCTCATTTTGGCTATACTGCATCACTTATATTTTTATCACGTTCAG
TGTGCTGGGATGAGGTTACGAGTAGCCATGTGCCATATGATTTATCGGAAGGCACTTCGT
CTTAGTAACATGGCCATGGGGAAGACAACCACAGGCCAGATAGTCAATCTGCTGTCCAAT
GATGTGAACAAGTTTGATCAGGTGACAGTGTTCTTACACTTCCTGTGGGCAGGACCACTG
CAGGCGATCGCAGTGACTGCCCTACTCTGGATGGAGATAGGAATATCGTGCCTTGCTGGG
ATGGCAGTTCTAATCATTCTCCTGCCCTTGCAAAGCTGTTTTGGGAAGTTGTTCTCATCA
CTGAGGAGTAAAACTGCAACTTTCACGGATGCCAGGATCAGGACCATGAATGAAGTTATA
ACTGGTATAAGGATAATAAAAATGTACGCCTGGGAAAAGTCATTTTCAAATCTTATTACC
AATTTGAGAAAGAAGGAGATTTCCAAGATTCTGAGAAGTTCCTGCCTCAGGGGGATGAAT
TTGGCTTCGTTTTTCAGTGCAAGCAAAATCATCGTGTTTGTGACCTTCACCACCTACGTG
CTCCTCGGCAGTGTGATCACAGCCAGCCGCGTGTTCGTGGCAGTGACGCTGTATGGGGCT
GTGCGGCTGACGGTTACCCTCTTCTTCCCCTCAGCCATTGAGAGGGTGTCAGAGGCAATC
GTCAGCATCCGAAGAATCCAGACCTTTTTGCTACTTGATGAGATATCACAGCGCAACCGT
CAGCTGCCGTCAGATGGTAAAAAGATGGTGCATGTGCAGGATTTTACTGCTTTTTGGGAT
AAGGCATCAGAGACCCCAACTCTACAAGGCCTTTCCTTTACTGTCAGACCTGGCGAATTG
TTAGCTGTGGTCGGCCCCGTGGGAGCAGGGAAGTCATCACTGTTAAGTGCCGTGCTCGGG
GAATTGGCCCCAAGTCACGGGCTGGTCAGCGTGCATGGAAGAATTGCCTATGTGTCTCAG
CAGCCCTGGGTGTTCTCGGGAACTCTGAGGAGTAATATTTTATTTGGGAAGAAATACGAA
AAGGAACGATATGAAAAAGTCATAAAGGCTTGTGCTCTGAAAAAGGATTTACAGCTGTTG
GAGGATGGTGATCTGACTGTGATAGGAGATCGGGGAACCACGCTGAGTGGAGGGCAGAAA
GCACGGGTAAACCTTGCAAGAGCAGTGTATCAAGATGCTGACATCTATCTCCTGGACGAT
CCTCTCAGTGCAGTAGATGCGGAAGTTAGCAGACACTTGTTCGAACTGTGTATTTGTCAA
ATTTTGCATGAGAAGATCACAATTTTAGTGACTCATCAGTTGCAGTACCTCAAAGCTGCA
AGTCAGATTCTGATATTGAAAGATGGTAAAATGGTGCAGAAGGGGACTTACACTGAGTTC
CTAAAATCTGGTATAGATTTTGGCTCCCTTTTAAAGAAGGATAATGAGGAAAGTGAACAA
CCTCCAGTTCCAGGAACTCCCACACTAAGGAATCGTACCTTCTCAGAGTCTTCGGTTTGG
TCTCAACAATCTTCTAGACCCTCCTTGAAAGATGGTGCTCTGGAGAGCCAAGATACAGAG
AATGTCCCAGTTACACTATCAGAGGAGAACCGTTCTGAAGGAAAAGTTGGTTTTCAGGCC
TATAAGAATTACTTCAGAGCTGGTGCTCACTGGATTGTCTTCATTTTCCTTATTCTCCTA
AACACTGCAGCTCAGGTTGCCTATGTGCTTCAAGATTGGTGGCTTTCATACTGGGCAAAC
AAACAAAGTATGCTAAATGTCACTGTAAATGGAGGAGGAAATGTAACCGAGAAGCTAGAT
CTTAACTGGTACTTAGGAATTTATTCAGGTTTAACTGTAGCTACCGTTCTTTTTGGCATA
GCAAGATCTCTATTGGTATTCTACGTCCTTGTTAACTCTTCACAAACTTTGCACAACAAA
ATGTTTGAGTCAATTCTGAAAGCTCCGGTATTATTCTTTGATAGAAATCCAATAGGAAGA
ATTTTAAATCGTTTCTCCAAAGACATTGGACACTTGGATGATTTGCTGCCGCTGACGTTT
TTAGATTTCATCCAGACATTGCTACAAGTGGTTGGTGTGGTCTCTGTGGCTGTGGCCGTG
ATTCCTTGGATCGCAATACCCTTGGTTCCCCTTGGAATCATTTTCATTTTTCTTCGGCGA
TATTTTTTGGAAACGTCAAGAGATGTGAAGCGCCTGGAATCTACAACTCGGAGTCCAGTG
TTTTCCCACTTATCATCTTCTCTCCAGGGGCTCTGGACCATCCGGGCATACAAAGCAGAA
GAGAGGTGTCAGGAACTGTTTGATGCACACCAGGATTTACATTCAGAGGCTTGGTTCTTG
TTTTTGACAACGTCCCGCTGGTTTGCCGTCCGTCTGGATGCCATCTGTGCCATGTTTGTC
ATCATCGTTGCCTTTGGGTCCCTGATTCTGGCAAAAACTCTGGATGCCGGGCAGGTTGGT
TTGGCACTGTCCTATGCCCTCACGCTCATGGGGATGTTTCAGTGGTGTGTTCGACAAAGT
GCTGAAGTTGAGAATATGATGATCTCAGTAGAAAGGGTCATTGAATACACAGACCTTGAA
AAAGAAGCACCTTGGGAATATCAGAAACGCCCACCACCAGCCTGGCCCCATGAAGGAGTG
ATAATCTTTGACAATGTGAACTTCATGTACAGTCCAGGTGGGCCTCTGGTACTGAAGCAT
CTGACAGCACTCATTAAATCACAAGAAAAGGTTGGCATTGTGGGAAGAACCGGAGCTGGA
AAAAGTTCCCTCATCTCAGCCCTTTTTAGATTGTCAGAACCCGAAGGTAAAATTTGGATT
GATAAGATCTTGACAACTGAAATTGGACTTCACGATTTAAGGAAGAAGATGTCAATCATA
CCTCAGGAACCTGTTTTGTTCACTGGAACAATGAGGAAAAACCTGGATCCCTTTAATGAG
CACACGGATGAGGAACTGTGGAATGCCTTACAAGAGGTACAACTTAAAGAAACCATTGAA
GATCTTCCTGGTAAAATGGATACTGAATTAGCAGAATCAGGATCCAATTTTAGTGTTGGA
CAAAGACAACTGGTGTGCCTTGCCAGGGCAATTCTCAGGAAAAATCAGATATTGATTATT
GATGAAGCGACGGCAAATGTGGATCCAAGAACTGATGAGTTAATACAAAAAAAAATCCGG
GAGAAATTTGCCCACTGCACCGTGCTAACCATTGCACACAGATTGAACACCATTATTGAC
AGCGACAAGATAATGGTTTTAGATTCAGGAAGACTGAAAGAATATGATGAGCCGTATGTT
TTGCTGCAAAATAAAGAGAGCCTATTTTACAAGATGGTGCAACAACTGGGCAAGGCAGAA
GCCGCTGCCCTCACTGAAACAGCAAAACAGGTATACTTCAAAAGAAATTATCCACATATT
GGTCACACTGACCACATGGTTACAAACACTTCCAATGGACAGCCCTCGACCTTAACTATT
TTCGAGACAGCACTGTGA

Clone variation with respect to NM_005845.3
669 t=>c;951 a=>g;969 a=>g
Tag Tag Free
ACCN NM_005845
ORF Size 3978 bp
Insert Size 5800
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone. This clone may be unstable or toxic at high copy number in common E. coli strain. We recommend using a lower copy number E. coli strain, such as CopyCutter strain (http://www.epibio.com/item.asp?ID=435) for transformation and plasmid preparation. Please be aware that the DNA yield could be low. Additional aliquots of this clone can be ordered from OriGene.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_005845.2, NP_005836
RefSeq Size 5871
RefSeq ORF 3978
Locus ID 10257
Cytogenetics 13q32.1
Domains ABC_membrane, ABC_tran, AAA
Protein Families Ion Channels: Other, Transmembrane, Druggable Genome
Protein Pathways ABC transporters
Gene Summary May be an organic anion pump relevant to cellular detoxification. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.