Gelsolin(GSN) (NM_000177) Human Untagged Clone

CAT#: SC120033

GSN (untagged)-Human gelsolin (GSN), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Gelsolin(GSN) (NM_000177) Human Untagged Clone
Symbol GSN
Synonyms ADF; AGEL
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_000177, the custom clone sequence may differ by one or more nucleotides


ATGGCTCCGCACCGCCCCGCGCCCGCGCTGCTTTGCGCGCTGTCCCTGGCGCTGTGCGCGCTGTCGCTGC
CCGTCCGCGCGGCCACTGCGTCGCGGGGGGCGTCCCAGGCGGGGGCGCCCCAGGGGCGGGTGCCCGAGGC
GCGGCCCAACAGCATGGTGGTGGAACACCCCGAGTTCCTCAAGGCAGGGAAGGAGCCTGGCCTGCAGATC
TGGCGTGTGGAGAAGTTCGATCTGGTGCCCGTGCCCACCAACCTTTATGGAGACTTCTTCACGGGCGACG
CCTACGTCATCCTGAAGACAGTGCAGCTGAGGAACGGAAATCTGCAGTATGACCTCCACTACTGGCTGGG
CAATGAGTGCAGCCAGGATGAGAGCGGGGCGGCCGCCATCTTTACCGTGCAGCTGGATGACTACCTGAAC
GGCCGGGCCGTGCAGCACCGTGAGGTCCAGGGCTTCGAGTCGGCCACCTTCCTAGGCTACTTCAAGTCTG
GCCTGAAGTACAAGAAAGGAGGTGTGGCATCAGGATTCAAGCACGTGGTACCCAACGAGGTGGTGGTGCA
GAGACTCTTCCAGGTCAAAGGGCGGCGTGTGGTCCGTGCCACCGAGGTACCTGTGTCCTGGGAGAGCTTC
AACAATGGCGACTGCTTCATCCTGGACCTGGGCAACAACATCCACCAGTGGTGTGGTTCCAACAGCAATC
GGTATGAAAGACTGAAGGCCACACAGGTGTCCAAGGGCATCCGGGACAACGAGCGGAGTGGCCGGGCCCG
AGTGCACGTGTCTGAGGAGGGCACTGAGCCCGAGGCGATGCTCCAGGTGCTGGGCCCCAAGCCGGCTCTG
CCTGCAGGTACCGAGGACACCGCCAAGGAGGATGCGGCCAACCGCAAGCTGGCCAAGCTCTACAAGGTCT
CCAATGGTGCAGGGACCATGTCCGTCTCCCTCGTGGCTGATGAGAACCCCTTCGCCCAGGGGGCCCTGAA
GTCAGAGGACTGCTTCATCCTGGACCACGGCAAAGATGGGAAAATCTTTGTCTGGAAAGGCAAGCAGGCA
AACACGGAGGAGAGGAAGGCTGCCCTCAAAACAGCCTCTGACTTCATCACCAAGATGGACTACCCCAAGC
AGACTCAGGTCTCGGTCCTTCCTGAGGGCGGTGAGACCCCACTGTTCAAGCAGTTCTTCAAGAACTGGCG
GGACCCAGACCAGACAGATGGCCTGGGCTTGTCCTACCTTTCCAGCCATATCGCCAACGTGGAGCGGGTG
CCCTTCGACGCCGCCACCCTGCACACCTCCACTGCCATGGCCGCCCAGCACGGCATGGATGACGATGGCA
CAGGCCAGAAACAGATCTGGAGAATCGAAGGTTCCAACAAGGTGCCCGTGGACCCTGCCACATATGGACA
GTTCTATGGAGGCGACAGCTACATCATTCTGTACAACTACCGCCATGGTGGCCGCCAGGGGCAGATAATC
TATAACTGGCAGGGTGCCCAGTCTACCCAGGATGAGGTCGCTGCATCTGCCATCCTGACTGCTCAGCTGG
ATGAGGAGCTGGGAGGTACCCCTGTCCAGAGCCGTGTGGTCCAAGGCAAGGAGCCCGCCCACCTCATGAG
CCTGTTTGGTGGGAAGCCCATGATCATCTACAAGGGCGGCACCTCCCGCGAGGGCGGGCAGACAGCCCCT
GCCAGCACCCGCCTCTTCCAGGTCCGCGCCAACAGCGCTGGAGCCACCCGGGCTGTTGAGGTATTGCCTA
AGGCTGGTGCACTGAACTCCAACGATGCCTTTGTTCTGAAAACCCCCTCAGCCGCCTACCTGTGGGTGGG
TACAGGAGCCAGCGAGGCAGAGAAGACGGGGGCCCAGGAGCTGCTCAGGGTGCTGCGGGCCCAACCTGTG
CAGGTGGCAGAAGGCAGCGAGCCAGATGGCTTCTGGGAGGCCCTGGGCGGGAAGGCTGCCTACCGCACAT
CCCCACGGCTGAAGGACAAGAAGATGGATGCCCATCCTCCTCGCCTCTTTGCCTGCTCCAACAAGATTGG
ACGTTTTGTGATCGAAGAGGTTCCTGGTGAGCTCATGCAGGAAGACCTGGCAACGGATGACGTCATGCTT
CTGGACACCTGGGACCAGGTCTTTGTCTGGGTTGGAAAGGATTCTCAAGAAGAAGAAAAGACAGAAGCCT
TGACTTCTGCTAAGCGGTACATCGAGACGGACCCAGCCAATCGGGATCGGCGGACGCCCATCACCGTGGT
GAAGCAAGGCTTTGAGCCTCCCTCCTTTGTGGGCTGGTTCCTTGGCTGGGATGATGATTACTGGTCTGTG
GACCCCTTGGACAGGGCCATGGCTGAGCTGGCTGCCTGA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_000177 unedited
AGGTCACATTTTGTAAACGACTCACTATAGGGCGGCCGCGAATTCGCACNGGGGCTGCCG
ACTGGGTCCCCTGCCGCTGTCGCCACCATGGCTCCGCACCGCCCCGCGCCCGCGCTGCTT
TGCGCGCTGTCCCTGGCGCTGTGCGCGCTGTCGCTGCCCGTCCGCGCGGCCACTGCGTCG
CGGGGGGCGTCCCAGGCGGGGGCGCCCCAGGGGCGGGTGCCCGAGGCGCGGCCCAACAGC
ATGGTGGTGGAACACCCCGAGTTCCTCAAGGCAGGGAAGGAGCCTGGCCTGCAGATCTGG
CGTGTGGAGAAGTTCGATCTGGTGCCCGTGCCCACCAACCTTTATGGAGACTTCTTCACG
GGCGACGCCTACGTCATCCTGAAGACAGTGCAGCTGAGGAACGGAAATCTGCAGTATGAC
CTCCACTACTGGCTGGGCAATGAGTGCAGCCAGGATGAGAGCGGGGCGGCCGCCATCTTT
ACCGTGCAGCTGGATGACTACCTGAACGGCCGGGCCGTGCAGCACCGTGAGGTCCAGGGC
TTCGAGTCGGCCACCTTCCTAGGCTACTTCAAGTCTGGCCTGAAGTACAAGAAAGGAGGT
GTGGCATCAGGATTCAAGCACGTGGTACCCAACGAGGTGGTGGTGCAGAGACTCTTCCAG
GTCAAAGGGCGGCGTGTGGTCCGTGCCACCGAGGTACCTGTGTCCTGGGAGAGCTTCAAC
AATGGCGACTGCTTCATCCTGGACCTGGGCAACAACATCCACCAGTGGTGTGGTTCCAAC
AGCAAATCGTATGAAAGACTGAANGCCACACNAGTGTCCAAGGGCATNCGGGACACGAGC
CGAGTGGCCGGGCCCGAGTGCACGTGTCTGGAGAGGGCACTGAGCCCGAGGCGATGCCTC
AGGTGCTGGGCCCCAAGCCGGCTCTGCCCTGAAGTACCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000177 unedited
GGACGCGGCCGCAATCTAAAGTCGAGTTTTTTTTTTTTTTTTTTCACACTTCAAAATGTT
TTTATTGGATTTAATTTCCCAAACATTGACATTTTAAACAATTTTGCAAGGACTCTGAAT
TTTTGCAGGGCTATTTTTGGATACTGTAAAAAAAAAAAAAAGAAACAACACACACACACA
CACACACTCATAGCAGAGCTGCTCTGCTCGCTCTAAGGCCTCTTTGAGGGAAGGACAGTT
CCAAAAGGCACTGACCGGTGACATGGGTGGGCCCTGCCCCTCCTCAGGCAGCCAGCTCAG
CCATGGCCCTGTCCAAGGGGTCCACAGACCAGTAATCATCATCCCAGTCAAGGAACCAGC
CCACAAAGGAGGGAGGCTCAAAGCCTTGCTTAACCACGGTGATGGGCGTCCGCCGATCCC
GATTGGCTGGGACCGCCTCGATGTACCGTTTAGCACAAGCCAAGGCTTCCGTCTTCCCTT
CTTCTTGAGAATCCTTTACAACCCACACAAAGACCTGGTCCCAGCTGTCCAGAAGCATGA
CGCCATCCCGCGCCAGGACTTCCTGCATGAGCTCACCAGGAACCTCTTTCATCACAAAAC
GTTCAATCTTGTTGGAGCAGGCAAAGAGGCGAGGAGGATGGCCATCCATCTTCTTGTCCT
TCAACCGTGGGGATGCGCGTAAGGCAAACCTCCCGCCACGGCCTCCCAGAAGCATCTGGC
TCGCTGCCTTCTGCCACCTGCAAGGTTGCGCCCGCACACCCTGAGAACTCCTGGCCCCCG
CTTTCTCTGCCTTGCTGCTCCTGACCCACCCCCAGGTAGTCGGCTGAAGAGGCTCTAAGA
ACAAAGCCCCGGTGGAGTTATTGCACCACCTCTAGAATAACTAAAAGACCCGGCGGTTCC
ACCCTTGTGTCCGTACCCGTAAAACTGGCCCTGCAAGGCT
Restriction Sites -     
Tag Tag Free
ACCN NM_000177
ORF Size 2349 bp
Insert Size 2700
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000177.3, NP_000168
RefSeq Size 2705
RefSeq ORF 2349
Locus ID 2934
Cytogenetics 9q33.2
Domains GEL, Gelsolin
Protein Families Secreted Protein, Druggable Genome
Protein Pathways Fc gamma R-mediated phagocytosis, Regulation of actin cytoskeleton
Gene Summary The protein encoded by this gene binds to the 'plus' ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (1) represents the longest isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations