Rb(RB1) (NM_000321) Human Untagged Clone

CAT#: SC119971

RB1 (untagged)-Human retinoblastoma 1 (RB1)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Rb(RB1) (NM_000321) Human Untagged Clone
Symbol RB1
Synonyms OSRC; p105-Rb; pp110; PPP1R130; pRb; RB
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene ORF sequence for NM_000321 edited
GGGGAGGGCGCGTCCGGTTTTTCTCAGGGGACGTTGAAATTATTTTTGTAACGGGAGTCG
GGAGAGGACGGGGCGTGCCCCGACGTGCGCGCGCGTCGTCCTCCCCGGCGCTCCTCCACA
GCTCGCTGGCTCCCGCCGCGGAAAGGCGTCATGCCGCCCAAAACCCCCCGAAAAACGGCC
GCCACCGCCGCCGCTGCCGCCGCGGAACCCCCGGCACCGCCGCCGCCGCCCCCTCCTGAG
GAGGACCCAGAGCAGGACAGCGGCCCGGAGGACCTGCCTCTCGTCAGGCTTGAGTTTGAA
GAAACAGAAGAACCTGATTTTACTGCATTATGTCAGAAATTAAAGATACCAGATCATGTC
AGAGAGAGAGCTTGGTTAACTTGGGAGAAAGTTTCATCTGTGGATGGAGTATTGGGAGGT
TATATTCAAAAGAAAAAGGAACTGTGGGGAATCTGTATCTTTATTGCAGCAGTTGACCTA
GATGAGATGTCGTTCACTTTTACTGAGCTACAGAAAAACATAGAAATCAGTGTCCATAAA
TTCTTTAACTTACTAAAAGAAATTGATACCAGTACCAAAGTTGATAATGCTATGTCAAGA
CTGTTGAAGAAGTATGATGTATTGTTTGCACTCTTCAGCAAATTGGAAAGGACATGTGAA
CTTATATATTTGACACAACCCAGCAGTTCGATATCTACTGAAATAAATTCTGCATTGGTG
CTAAAAGTTTCTTGGATCACATTTTTATTAGCTAAAGGGGAAGTATTACAAATGGAAGAT
GATCTGGTGATTTCATTTCAGTTAATGCTATGTGTCCTTGACTATTTTATTAAACTCTCA
CCTCCCATGTTGCTCAAAGAACCATATAAAACAGCTGTTATACCCATTAATGGTTCACCT
CGAACACCCAGGCGAGGTCAGAACAGGAGTGCACGGATAGCAAAACAACTAGAAAATGAT
ACAAGAATTATTGAAGTTCTCTGTAAAGAACATGAATGTAATATAGATGAGGTGAAAAAT
GTTTATTTCAAAAATTTTATACCTTTTATGAATTCTCTTGGACTTGTAACATCTAATGGA
CTTCCAGAGGTTGAAAATCTTTCTAAACGATACGAAGAAATTTATCTTAAAAATAAAGAT
CTAGATGCAAGATTATTTTTGGATCATGATAAAACTCTTCAGACTGATTCTATAGACAGT
TTTGAAACACAGAGAACACCACGAAAAAGTAACCTTGATGAAGAGGTGAATGTAATTCCT
CCACACACTCCAGTTAGGACTGTTATGAACACTATCCAACAATTAATGATGATTTTAAAT
TCAGCAAGTGATCAACCTTCAGAAAATCTGATTTCCTATTTTAACAACTGCACAGTGAAT
CCAAAAGAAAGTATACTGAAAAGAGTGAAGGATATAGGATACATCTTTAAAGAGAAATTT
GCTAAAGCTGTGGGACAGGGTTGTGTCGAAATTGGATCACAGCGATACAAACTTGGAGTT
CGCTTGTATTACCGAGTAATGGAATCCATGCTTAAATCAGAAGAAGAACGATTATCCATT
CAAAATTTTAGCAAACTTCTGAATGACAACATTTTTCATATGTCTTTATTGGCGTGCGCT
CTTGAGGTTGTAATGGCCACATATAGCAGAAGTACATCTCAGAATCTTGATTCTGGAACA
GATTTGTCTTTCCCATGGATTCTGAATGTGCTTAATTTAAAAGCCTTTGATTTTTACAAA
GTGATCGAAAGTTTTATCAAAGCAGAAGGCAACTTGACAAGAGAAATGATAAAACATTTA
GAACGATGTGAACATCGAATCATGGAATCCCTTGCATGGCTCTCAGATTCACCTTTATTT
GATCTTATTAAACAATCAAAGGACCGAGAAGGACCAACTGATCACCTTGAATCTGCTTGT
CCTCTTAATCTTCCTCTCCAGAATAATCACACTGCAGCAGATATGTATCTTTCTCCTGTA
AGATCTCCAAAGAAAAAAGGTTCAACTACGCGTGTAAATTCTACTGCAAATGCAGAGACA
CAAGCAACCTCAGCCTTCCAGACCCAGAAGCCATTGAAATCTACCTCTCTTTCACTGTTT
TATAAAAAAGTGTATCGGCTAGCCTATCTCCGGCTAAATACACTTTGTGAACGCCTTCTG
TCTGAGCACCCAGAATTAGAACATATCATCTGGACCCTTTTCCAGCACACCCTGCAGAAT
GAGTATGAACTCATGAGAGACAGGCATTTGGACCAAATTATGATGTGTTCCATGTATGGC
ATATGCAAAGTGAAGAATATAGACCTTAAATTCAAAATCATTGTAACAGCATACAAGGAT
CTTCCTCATGCTGTTCAGGAGACATTCAAACGTGTTTTGATCAAAGAAGAGGAGTATGAT
TCTATTATAGTATTCTATAACTCGGTCTTCATGCAGAGACTGAAAACAAATATTTTGCAG
TATGCTTCCACCAGGCCCCCTACCTTGTCACCAATACCTCACATTCCTCGAAGCCCTTAC
AAGTTTCCTAGTTCACCCTTACGGATTCCTGGAGGGAACATCTATATTTCACCCCTGAAG
AGTCCATATAAAATTTCAGAAGGTCTGCCAACACCAACAAAAATGACTCCAAGATCAAGA
ATCTTAGTATCAATTGGTGAATCATTCGGGACTTCTGAGAAGTTCCAGAAAATAAATCAG
ATGGTATGTAACAGCGACCGTGTGCTCAAAAGAAGTGCTGAAGGAAGCAACCCTCCTAAA
CCACTGAAAAAACTACGCTTTGATATTGAAGGATCAGATGAAGCAGATGGAAGTAAACAT
CTCCCAGGAGAGTCCAAATTTCAGCAGAAACTGGCAGAAATGACTTCTACTCGAACACGA
ATGCAAAAGCAGAAAATGAATGATAGCATGGATACCTCAAACAAGGAAGAGAAATGAGGA
TCTCAGGACCTTGGTGGACACTGTGTACACCTCTGGATTCATTGTCTCTCACAGATGTGA
CTGTATAACTTTCCCAGGTTCTGTTTATGGCCACATTTAATATCTTCAGCTCTTTTTGTG
GATATAAAATGTGCAGATGCAATTGTTTGGGTGATTCCTAAGCCACTTGAAATGTTAGTC
ATTGTTATTTATACAAGATTGAAAATCTTGTGTAAATCCTGCCATTTAAAAAGTTGTAGC
AGATTGTTTCCTCTTCCAAAGTAAAATTGCTGTGCTTTATGGATAGTAAGAATGGCCCTA
GAGTGGGAGTCCTGATAACCCAGGCCTGTCTGACTACTTTGCCTTCTTTTGTAGCATATA
GGTGATGTTTGCTCTTGT
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000321 unedited
NNNNGGTTCACATTTGTATACGACTCATATAGGCGGCCGCGNAATTCGCACGAGGCGGGA
GAGGACGGGGCGTGCCCCGACGTGCGCGCGCGTCGTCCTCCCCGGCGCTCCTCCACAGCT
CGCTGGCTCCCGCCGCGGAAAGGCGTCATGCCGCCCAAAACCCCCCGAAAAACGGCCGCC
ACCGCCGCCGCTGCCGCCGCGGAACCCCCGGCACCGCCGCCGCCGCCCCCTCCTGAGGAG
GACCCAGAGCAGGACAGCGGCCCGGAGGACCTGCCTCTCGTCAGGCTTGAGTTTGAAGAA
ACAGAAGAACCTGATTTTACTGCATTATGTCAGAAATTAAAGATACCAGATCATGTCAGA
GAGAGAGCTTGGTTAACTTGGGAGAAAGTTTCATCTGTGGATGGAGTATTGGGAGGTTAT
ATTCAAAAGAAAAAGGAACTGTGGGGAATCTGTATCTTTATTGCAGCAGTTGACCTAGAT
GAGATGTCGTTCACTTTTACTGAGCTACAGAAAAACATAGAAATCAGTGTCCATAAATTC
TTTAACTTACTAAAAGAAATTGATACCAGTACCAAAGTTGATAATGCTATGTCAAGACTG
TTGAAGAAGTATGATGTATTGTTTGCACTCTTCAGCAAATTGGAAAGGACATGTGAACTT
ATATATTTGACACAACCCAGCAGTTCGATATCTACTGAAATAAATTCTGCATTGGTGCTA
AAAGTTTCTTGGATCACATTTTTATTAGCTAAAGGGGAAGTATTACAAATGGAAGATGAT
CTGGTGATTTCATTTCAGTTAATGCTATGTGTCCTTGACTATTTTATTAAACTCTCACCT
CCCATGTTGCTCAAAGAACCATATAAAACAGCTGTTATACCCATT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000321 unedited
NNNGGTATTTCTTTGGACCGCGGNNCCGCATTTNANGATCGAGTTTTTTTTTTTTTTTTT
TTTTTTTTTAAAACTCTTAACAACTAATTTATTTTAAAATAGACAAACTATTAATTGTAG
AAAATAGTAACATAGCAATTTTAAATGTACAGTTTTAACCAATACAAAAAAGCAATAAAG
CAATAATATCTGAAGCATTATTTAAGAAATCTCAATACACGATCTCTGAAGTTCCTAAAA
TTCTGGCACTAATTCTAATGGGAACTTAGTAGCAAAAGACCCAGAAATAGTAAGCCCTTG
ACCTAAAAACTAACTGATTTGTATGATATTCATGCAGAAACAATGATGAAATGGAGTCAA
GTTTTCTAGTGTCATTGTTATCAAAATAACTGTCAAAATAGTAAGTTTGAAACTTAAATG
AGCACAAAATAAAATTTTGTTTTCTAACAAGACCAGATTTCTTTTTAAAAATAATTCTGA
GTTAGACAAAGTGATTTTCCTAAAAGCTAGCTGAAGCTACCTTAAATATCCCCTATTTTA
AGTTACAGCATCTCTAAATAAGTTAATCACACAAGATAGTTTAAATACACCTTTAGGTGT
AGGGGAGGGGAGAAGCGCCTCTTTTTCTAATGCAGCTGTTTTAATTTGAAGCTTTTGCAC
AAAATCAGATAGAAACATTAATGCCTAACCCATAATGACCCTTGATTACTTGTAATTTTG
GACTAGAAAAATGTGGCTTTGAACATGCCAGTGTTAGACCATACTGACTTAAAAAATAAA
AGATAAATAGCCATTTGCCAGTTCAAAAGATCATGGAAGAATGTACCATTCCAGAAAAAC
ACANACCTTTCCAAATTAAGGAGGCAGAATAATTTGAGATGCATTAGACAAACTCTCAGA
AAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000321
ORF Size 2787 bp
Insert Size 4600
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000321.1, NP_000312
RefSeq Size 4740
Locus ID 5925
Cytogenetics 13q14.2
Domains RB_B, RB_A, CYCLIN
Protein Families Transcription Factors, Druggable Genome
Protein Pathways Cell cycle, Pathways in cancer, Pancreatic cancer, Glioma, Prostate cancer, Melanoma, Bladder cancer, Chronic myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer
Gene Summary The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations