PTEN (NM_000314) Human Untagged Clone

CAT#: SC119965

PTEN (untagged)-Human phosphatase and tensin homolog (PTEN)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name PTEN (NM_000314) Human Untagged Clone
Symbol PTEN
Synonyms 10q23del; BZS; CWS1; DEC; GLM2; MHAM; MMAC1; PTEN1; TEP1
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000314 edited
GAATTCGGCACGAGGGCCAAGCGGCGGCAGAGCGAGGGGCATCAGCTACCGCCAAGTCCA
GAGCCATTTCCATCCTGCAGAAGAAGCCCCGCCACCAGCAGCTTCTGCCATCTCTCTCCT
CCTTTTTCTTCAGCCACAGGCTCCCAGACATGACAGCCATCATCAAAGAGATCGTTAGCA
GAAACAAAAGGAGATATCAAGAGGATGGATTCGACTTAGACTTGACCTATATTTATCCAA
ACATTATTGCTATGGGATTTCCTGCAGAAAGACTTGAAGGCGTATACAGGAACAATATTG
ATGATGTAGTAAGGTTTTTGGATTCAAAGCATAAAAACCATTACAAGATATACAATCTTT
GTGCTGAAAGACATTATGACACCGCCAAATTTAATTGCAGAGTTGCACAATATCCTTTTG
AAGACCATAACCCACCACAGCTAGAACTTATCAAACCCTTTTGTGAAGATCTTGACCAAT
GGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACTGTAAAGCTGGAAAGGGACGAA
CTGGTGTAATGATATGTGCATATTTATTACATCGGGGCAAATTTTTAAAGGCACAAGAGG
CCCTAGATTTCTATGGGGAAGTAAGGACCAGAGACAAAAAGGGAGTAACTATTCCCAGTC
AGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAATCATCTGGATTATAGACCAG
TGGCACTGTTGTTTCACAAGATGATGTTTGAAACTATTCCAATGTTCAGTGGCGGAACTT
GCAATCCTCAGTTTGTGGTCTGCCAGCTAAAGGTGAAGATATATTCCTCCAATTCAGGAC
CCACACGACGGGAAGACAAGTTCATGTACTTTGAGTTCCCTCAGCCGTTACCTGTGTGTG
GTGATATCAAAGTAGAGTTCTTCCACAAACAGAACAAGATGCTAAAAAAGGACAAAATGT
TTCACTTTTGGGTAAATACATTCTTCATACCAGGACCAGAGGAAACCTCAGAAAAAGTAG
AAAATGGAAGTCTATGTGATCAAGAAATCGATAGCATTTGCAGTATAGAGCGTGCAGATA
ATGACAAGGAATATCTAGTACTTACTTTAACAAAAAATGATCTTGACAAAGCAAATAAAG
ACAAAGCCAACCGATACTTTTCTCCAAATTTTAAGGTGAAGCTGTACTTCACAAAAACAG
TAGAGGAGCCGTCAAATCCAGAGGCTAGCAGTTCAACTTCTGTAACACCAGATGTTAGTG
ACAATGAACCTGATCATTATAGATATTCTGACACCACTGACTCTGATCCAGAGAATGAAC
CTTTTGATGAAGATCAGCATACACAAATTACAAAAGTCTGAATTTTTTTTTATCAAGAGG
GATAAAACACCATGAAAATAAACTTGAATAAACTGAAAATGGACCTTTTTTTTTTTAATG
GCAATAGGACATTGTGTCAGATTACCAGTTATAGGAACAATTCTCTTTTCCTGACCAATC
TTGTTTTACCCTATACATCCACAGGGTTTTGACACTTGTTGTCCAGTTGAAAAAAGGTTG
TGTAGCTGTGTCATGTATATACCTTTTTGTGTCAAAAGGACATTTAAAATTCAATTAGGA
TTAATAAAGATGGCACTTTCCCGTTTTATTCCAGTTTTATAAAAAGTGGAGACAGACTGA
TGTGTATACGTAGGAATTTTTTCCTTTTGTGTTCTGTCACCAACTGAAGTGGCTAAAGAG
CTTTGTGATATACTGGTTCACATCCTACCCCTTTGCACTTGTGGCAACAGATAAGTTTGC
AGTTGGCTAAGAGAGGTTTCCGAAGGGTTTTGCTACATTCTAATGCATGTATTCGGGTTA
GGGGAATGGAGGGAATGCTCAGAAAGGAAATAATTTTATGCTGGACTCTGGACCATATAC
CATCTCCAGCTATTTACACACACCTTTCTTTAGCATGCTACAGTTATTAATCTGGACATT
CGAGGAATTGGCCGCTGTCACTGCTTGTTGTTTGCGCATTTTTTTTTAAAGCATATTGGT
GCTAGAAAAGGCAGCTAAAGGAAGTGAATCTGTATTGGGGTACAGGAATGAACCTTCTGC
AACATCTTAAGATCCACAAATGAAGGGATATAAAAATAATGTCATAGGTAAGAAACACAG
CAACAATGACTTAACCATATAAATGTGGAGGCTATCAACAAAGAATGGGCTTGAAACATT
ATAAAAATTGACAATGATTTATTAAATATGTTTTCTCAATTGTAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000314 unedited
ACGACTCCTATAGGGCGGCCGCGAATTCGCACGAGGGCCAAGCGGCGGCAGAGCGAGGGG
CATCAGCTACCGCCAAGTCCAGAGCCATTTCCATCCTGCAGAAGAAGCCCCGCCACCAGC
AGCTTCTGCCATCTCTCTCCTCCTTTTTCTTCAGCCACAGGCTCCCAGACATGACAGCCA
TCATCAAAGAGATCGTTAGCAGAAACAAAAGGAGATATCAAGAGGATGGATTCGACTTAG
ACTTGACCTATATTTATCCAAACATTATTGCTATGGGATTTCCTGCAGAAAGACTTGAAG
GCGTATACAGGAACAATATTGATGATGTAGTAAGGTTTTTGGATTCAAAGCATAAAAACC
ATTACAAGATATACAATCTTTGTGCTGAAAGACATTATGACACCGCCAAATTTAATTGCA
GAGTTGCACAATATCCTTTTGAAGACCATAACCCACCACAGCTAGAACTTATCAAACCCT
TTTGTGAAGATCTTGACCAATGGCTAAGTGAAGATGACAATCATGTTGCAGCAATTCACT
GTAAAGCTGGAAAGGGACGAACTGGTGTAATGATATGTGCATATTTATTACATCGGGGCA
AATTTTTAAAGGCACAAGAGGCCCTAGATTTCTATGGNGAAGTAAGGACCAGAGACAAAA
GGGAGTAACTATTCCCAGTCAGAGGCGCTATGTGTATTATTATAGCTACCTGTTAAAGAT
CATCTGGATTATAGACCAGTGGCACTGGNTGTTCACAAGATGATGTTTGAAACTATNCCC
ATGGTCAGTGGCGGAACTTNGCATCCTCAGTTNGTGGTCTGCCAGCTAAGGGTGAAGAAT
ATNCCTCCATNCAGGACCACACGACGGGNAGACAGTCATGTCCTTTGAGTCCCTCAGCCG
TACCTGGGTGTGTGAATCAAAGAAAAGTCTTCCCAACAGACAGAGCTAAAAGGCAAATGN
NTACTTTGGTAAAACATNTNATACAGACAAAGAACTC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000314 unedited
ATGGACCGGCGGCCGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTACAATTGAGAAAAACATATTTAATAAATCATTGTCAATTTTTATAATGTTTCAAG
CCCATTCTTTGTTGATAGCCTCCACATTTATATGGTTAAGTCATTGTTGCTGGGTTTCTT
ACCTATGACATTATTTTTATATCCCTTCATTTGGGGATCTTAAAATGTTGCAAAAGGTTC
ATTCCTGTACCCCAATACAGATTCACTTCCTTTAGCTGCCTTTTCTAGCACCAATATGCT
TTAAAAAAAAATGCGCAAACAACAAGCAGGGACAGCGGCCAATTCCTCGAATGTCCAGAT
TAATAACTGTAGCATGCTAAAGAAAGGGGTGTGTAAATAGCTGGAGATGGTATATGGTCC
AGAGTCCAGCATAAAATTATTTCCTTTCTGAGCATTCCCTCCATTCCCCTAACCCGAATA
CATGCATTAAAATGTAGCAAAACCCTTCGGAAACCTCTCTTAGCCAACTGCAAACTTATC
TGTTGCCACAAGTGCAAAGGGGTAGGATGTGAACCAGTATATCACAAAGCTCTTTAGCCA
CTTCAGTTGGTGACAGAACACAAAAGGAAAAAATTCCTACGTATACACATCAGTCTGTCT
CCACTTTTTATAAAACTGGGATAAAACGGGAAAGNGCCATCTTTATTAATCCTAATTGAA
TTTTAAATGCCCTTTTGACACAAAAGTATATACATGACACAGCTACACAACCTTTTTTCA
ACTGGACANNCAGTGTCAAAACCCTGTGGTGTATAGGGTAAAACAAGATTGGTCAGGAAA
GAGAATTGTTCCTAAACTGGGNATCTGACACAGTGCCTATTGCCATAAAAAAAAAGGGCC
ATTTCAGTTATCCAAGTTATTTCATGGGGTTTATCCCTCTGAAAAAAAATCGACTTTGGA
ATGGGATGCGGACTCACAAAGGTATCCCTGA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000314
ORF Size 1212 bp
Insert Size 2390
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000314.3, NP_000305
RefSeq Size 3416
Locus ID 5728
Cytogenetics 10q23.31
Domains PTPc_motif
Protein Families Phosphatase, Druggable Genome
Protein Pathways Inositol phosphate metabolism, Phosphatidylinositol signaling system, p53 signaling pathway, Focal adhesion, Tight junction, Pathways in cancer, Endometrial cancer, Glioma, Prostate cancer, Melanoma, Small cell lung cancer
Gene Summary Isoform alpha: Functional kinase, like isoform 1 it antagonizes the PI3K-AKT/PKB signaling pathway. Plays a role in mitochondrial energetic metabolism by promoting COX activity and ATP production, via collaboration with isoform 1 in increasing protein levels of PINK1. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes multiple isoforms due to the use of alternative translation initiation codons. The longest isoform (PTEN-L, PMID:23744781; also known as PTENalpha, PMID: 24768297) is derived from the use of an upstream non-AUG (CUG) start codon, while two shorter isoforms are derived from downstream AUG start codons. The most abundant isoform (PTEN), which is derived from the use of 5'-most AUG start codon, is represented in this RefSeq.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations