MRP2(ABCC2) (NM_000392) Human Untagged Clone

CAT#: SC119897

ABCC2 (untagged)-Human ATP-binding cassette, sub-family C (CFTR/MRP), member 2 (ABCC2)

USD 1,041.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name MRP2(ABCC2) (NM_000392) Human Untagged Clone
Symbol ABCC2
Synonyms ABC30; CMOAT; cMRP; DJS; MRP2
Vector pCMV6-Neo
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000392 edited
GTCATCCTTTACGGAGAACATCAGAATGGTAGATAATTCCTGTTCCACTTTCTTTGATGA
AACAAGTAAAGAAGAAACAACACAATCATATTAATAGAAGAGTCTTCGTTCCAGACGCAG
TCCAGGAATCATGCTGGAGAAGTTCTGCAACTCTACTTTTTGGAATTCCTCATTCCTGGA
CAGTCCGGAGGCAGACCTGCCACTTTGTTTTGAGCAAACTGTTCTGGTGTGGATTCCCTT
GGGCTTCCTATGGCTCCTGGCCCCCTGGCAGCTTCTCCACGTGTATAAATCCAGGACCAA
GAGATCCTCTACCACCAAACTCTATCTTGCTAAGCAGGTATTCGTTGGTTTTCTTCTTAT
TCTAGCAGCCATAGAGCTGGCCCTTGTACTCACAGAAGACTCTGGACAAGCCACAGTCCC
TGCTGTTCGATATACCAATCCAAGCCTCTACCTAGGCACATGGCTCCTGGTTTTGCTGAT
CCAATACAGCAGACAATGGTGTGTACAGAAAAACTCCTGGTTCCTGTCCCTATTCTGGAT
TCTCTCGATACTCTGTGGCACTTTCCAATTTCAGACTCTGATCCGGACACTCTTACAGGG
TGACAATTCTAATCTAGCCTACTCCTGCCTGTTCTTCATCTCCTACGGATTCCAGATCCT
GATCCTGATCTTTTCAGCATTTTCAGAAAATAATGAGTCATCAAATAATCCATCATCCAT
AGCTTCATTCCTGAGTAGCATTACCTACAGCTGGTATGACAGCATCATTCTGAAAGGCTA
CAAGCGTCCTCTGACACTCGAGGATGTCTGGGAAGTTGATGAAGAGATGAAAACCAAGAC
ATTAGTGAGCAAGTTTGAAACGCACATGAAGAGAGAGCTGCAGAAAGCCAGGCGGGCACT
CCAGAGACGGCAGGAGAAGAGCTCCCAGCAGAACTCTGGAGCCAGGCTGCCTGGCTTGAA
CAAGAATCAGAGTCAAAGCCAAGATGCCCTTGTCCTGGAAGATGTTGAAAAGAAAAAAAA
GAAGTCTGGGACCAAAAAAGATGTTCCAAAATCCTGGTTGATGAAGGCTCTGTTCAAAAC
TTTCTACATGGTGCTCCTGAAATCATTCCTACTGAAGCTAGTGAATGACATCTTCACGTT
TGTGAGTCCTCAGCTGCTGAAATTGCTGATCTCCTTTGCAAGTGACCGTGACACATATTT
GTGGATTGGATATCTCTGTGCAATCCTCTTATTCACTGCGGCTCTCATTCAGTCTTTCTG
CCTTCAGTGTTATTTCCAACTGTGCTTCAAGCTGGGTGTAAAAGTACGGACAGCTATCAT
GGCTTCTGTATATAAGAAGGCATTGACCCTATCCAACTTGGCCAGGAAGGAGTACACCGT
TGGAGAAACAGTGAACCTGATGTCTGTGGATGCCCAGAAGCTCATGGATGTGACCAACTT
CATGCACATGCTGTGGTCAAGTGTTCTACAGATTGTCTTATCTATCTTCTTCCTATGGAG
AGAGTTGGGACCCTCAGTCTTAGCAGGTGTTGGGGTGATGGTGCTTGTAATCCCAATTAA
TGCGATACTGTCCACCAAGAGTAAGACCATTCAGGTCAAAAATATGAAGAATAAAGACAA
ACGTTTAAAGATCATGAATGAGATTCTTAGTGGAATCAAGATCCTGAAATATTTTGCCTG
GGAACCTTCATTCAGAGACCAAGTACAAAACCTCCGGAAGAAAGAGCTCAAGAACCTGCT
GGCCTTTAGTCAACTACAGTGTGTAGTAATATTCGTCTTCCAGTTAACTCCAGTCCTGGT
ATCTGTGGTCACATTTTCTGTTTATGTCCTGGTGGATAGCAACAATATTTTGGATGCACA
AAAGGCCTTCACCTCCATTACCCTCTTCAATATCCTGCGCTTTCCCCTGAGCATGCTTCC
CATGATGATCTCCTCCATGCTCCAGGCCAGTGTTTCCACAGAGCGGCTAGAGAAGTACTT
GGGAGGGGATGACTTGGACACATCTGCCATTCGACATGACTGCAATTTTGACAAAGCCAT
GCAGTTTTCTGAGGCCTCCTTTACCTGGGAACATGATTCGGAAGCCACAGTCCGAGATGT
GAACCTGGACATTATGGCAGGCCAACTTGTGGCTGTGATAGGCCCTGTCGGCTCTGGGAA
ATCCTCCTTGATATCAGCCATGCTG:GGAGAAATGGAAAATGTCCACGGGCACATCACCA
TCAAGGGCACCACTGCCTATGTCCCACAGCAGTCCTGGATTCAGAATGGCACCATAAAGG
ACAACATCCTTTTTGGAACAGAGTTTAATGAAAAGAGGTACCAGCAAGTACTGGAGGCCT
GTGCTCTCCTCCCAGACTTGGAAATGCTGCCTGGAGGAGATTTGGCTGAGATTGGAGAGA
AGGGTATAAATCTTAGTGGGGGTCAGAAGCAGCGGATCAGCCTGGCCAGAGCTACCTACC
AAAATTTAGACATCTATCTTCTAGATGACCCCCTGTCTGCAGTG:GATGCTCATGTAGGA
AAACATATTTTTAATAAGGTCTTGGGCCCCAATGGCCTGTTGAAAGGCAAGACTCGACTC
TTGGTTACACATAGCATGCACTTTCTTCCTCAAGTGGATGAGATTGTAGTTCTGGGGAAT
GGAACAATTGTAGAGAAAGGATCCTACAGTGCTCTCCTGGCCAAAAAAGGAGAGTTTGCT
AAGAATCTGAAGACATTTCTAAGACATACAGGCCCTGAAGAGGAAGCCACAGTCCATGAT
GGCAGTGAAGAAGAAGACGATGACTATGGGCTGATATCCAGTGTGGAAGAGATCCCCGAA
GATGCAGCCTCCATAACCATGAGAAGAGAGAACAGCTTTCGTCGAACACTTAGCCGCAGT
TCTAGGTCCAATGGCAGGCATCTGAAGTCCCTGAGAAACTCCTTGAAAACTCGGAATGTG
AATAGCCTGAAGGAAGACGAAGAACTAGTGAAAGGACAAAAACTAATTAAGAAGGAATTC
ATAGAAACTGGAAAGGTGAAGTTCTCCATCTACCTGGAGTACCTACAAGCAATAGGATTG
TTTTCGATATTCTTCATCATCCTTGCGTTTGTGATGAATTCTGTGGCTTTTATTGGATCC
AACCTCTGGCTCAGTGCTTGGACCAGTGACTCTAAAATCTTCAATAGCACCGACTATCCA
GCATCTCAGAGGGACATGAGAGTTGGAGTCTACGGAGCTCTGGGATTAGCCCAAGGTATA
TTTGTGTTCATAGCACATTTCTGGAGTGCCTTTGGTTTCGTCCATGCATCAAATATCTTG
CACAAGCAACTGCTGAACAATATCCTTCGAGCACCTATGAGATTTTTTGACACAACACCC
ACAGGCCGGATTGTGAACAGGTTTGCCGGCGATATTTCCACAGTGGATGACACCCTGCCT
CAGTCCTTGCGCAGCTGGATTACATGCTTCCTGGGGATAATCAGCACCCTTGTCATGATC
TGCATGGCCACTCCTGTCTTCACCATCATCGTCATTCCTCTTGGCATTATTTATGTATCT
GTTCAGATGTTTTATGTGTCTACCTCCCGCCAGCTGAGGCGTCTGGACTCTGTCACCAGG
TCCCCAATCTACTCTCACTTCAGCGAGACCGTATCAGGTTTGCCAGTTATCCGTGCCTTT
GAGCACCAGCAGCGATTTCTGAAACACAATGAGGTGAGGATTGACACCAACCAGAAATGT
GTCTTTTCCTGGATCACCTCCAACAGGTGGCTTGCAATTCGCCTGGAGCTGGTTGGGAAC
CTGACTGTCTTCTTTTCAGCCTTGATGATGGTTATTTATAGAGATACCCTAAGTGGGGAC
ACTGTTGGCTTTGTTCTGTCCAATGCACTCAATATCACACAAACCCTGAACTGGCTGGTG
AGGATGACATCAGAAATAGAGACCAACATTGTGGCTGTTGAGCGAATAACTGAGTACACA
AAAGTGGAAAATGAGGCACCCTGGGTGACTGATAAGAGGCCTCCGCCAGATTGGCCCAGC
AAAGGCAAGATCCAGTTTAACAACTACCAAGTGCGGTACCGACCTGAGCTGGATCTGGTC
CTCAG::::AGGGATCACTTGTG:::ACATCGGTAGCATGGAGAAGATTGGTGTGGTGGG
CAGGACAGGAGCTGGAAAGTCATCCCTCACAAACTGCCTCTTCAGAATCTTAGAGGCTGC
CGGTGGTCAGATTATCATTGATGGAGTAGATATTGCTTCCATTGGGCTCCACGACCTCCG
AGAGAAGCTGACCATCATCCCCCAGGACCCCATCCTGTTCTCTGGAAGCCTGAGGATGAA
TCTCGACCCTTTCAACAACTACTCAGATGAGGAGATTTGGAAGGCCTTGGAGCTGGCTCA
CCTCAAGTCTTTTGTGGCCAGCCTGCAACTTGGGTTATCCCACGAAGTGACAGAGGCTGG
TGGCAACCTGAGCATAGGCCAGAGGCAGCTGCTGTGCCTGGGCAGGGCTCTGCTTCGGAA
ATCCAAGATCCTGGTCCTGGATGAGGCCACTGCTGCGGTGGATCTAGAGACAGACAACCT
CATTCAGACGACCATCCAAAACGAGTTCGCCCACTGCACAGTGATCACCATCGCCCACAG
GCTGCACACCATCATGGACAGTGACAAGGTAATGGTCCTAGACAACGGGAAGATTATAGA
GTGCGGCAGCCCTGAAGAACTGCTACAAATCCCTGGACCCTTTTACTTTATGGCTAAGGA
AGCTGGCATTGAGAATGTGAACAGCACAAAATTCTAGCAGAAGGCCCCATGGGTTAGAAA
AGGACTATAAGAATAATTTCTTATTTAATTTTATTTTTTATAAAATACAGAATACATACA
AAAGTGTGTATAAAATGTACGTTTTAAAAAAGGATAAGTGAACACCCATGAACCTACTAC
CCAGGTTAAGAAAATAAATGTCACCAGGTACTTGAGAAACCCCTCGATTGTCTACCTCGA
TCGTACTTCCTTGCTACCCACCCCTCCCAGGGACAACCACTGTCCTGAATTTCACGATAA
TTATTCCTTTGCCTTTCATTTCTGTTTTATCACCTTTGTATGTATCTTTAAACAACATAT
ACCCTTTTTTACTTATGTAAATGGACTGACTCATACTGCATACATCTTCTATGACTTGAA
AAAAAAAAAA
Tag Tag Free
ACCN NM_000392
ORF Size 4638 bp
Insert Size 5200
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation TrueClone
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000392.1, NP_000383
RefSeq Size 4868
RefSeq ORF 4638
Locus ID 1244
Cytogenetics 10q24.2
Domains ABC_membrane, ABC_tran, AAA
Protein Families Transmembrane, Druggable Genome
Protein Pathways ABC transporters
Gene Summary Mediates hepatobiliary excretion of numerous organic anions. May function as a cellular cisplatin transporter. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations