5 HT 2A(HTR2A) (NM_000621) Human Untagged Clone

CAT#: SC119793

HTR2A (untagged)-Human 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name 5 HT 2A(HTR2A) (NM_000621) Human Untagged Clone
Symbol HTR2A
Synonyms 5-HT2A; HTR2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119793 sequence for NM_000621 edited (data generated by NextGen Sequencing)


ATGGATATTCTTTGTGAAGAAAATACTTCTTTGAGCTCAACTACGAACTCCCTAATGCAATTAAATGATG
ACAACAGGCTCTACAGTAATGACTTTAACTCCGGAGAAGCTAACACTTCTGATGCATTTAACTGGACAGT
CGACTCTGAAAATCGAACCAACCTTTCCTGTGAAGGGTGCCTCTCACCGTCGTGTCTCTCCTTACTTCAT
CTCCAGGAAAAAAACTGGTCTGCTTTACTGACAGCCGTAGTGATTATTCTAACTATTGCTGGAAACATAC
TCGTCATCATGGCAGTGTCCCTAGAGAAAAAGCTGCAGAATGCCACCAACTATTTCCTGATGTCACTTGC
CATAGCTGATATGCTGCTGGGTTTCCTTGTCATGCCCGTGTCCATGTTAACCATCCTGTATGGGTACCGG
TGGCCTCTGCCGAGCAAGCTTTGTGCAGTCTGGATTTACCTGGACGTGCTCTTCTCCACGGCCTCCATCA
TGCACCTCTGCGCCATCTCGCTGGACCGCTACGTCGCCATCCAGAATCCCATCCACCACAGCCGCTTCAA
CTCCAGAACTAAGGCATTTCTGAAAATCATTGCTGTTTGGACCATATCAGTAGGTATATCCATGCCAATA
CCAGTCTTTGGGCTACAGGACGATTCGAAGGTCTTTAAGGAGGGGAGTTGCTTACTCGCCGATGATAACT
TTGTCCTGATCGGCTCTTTTGTGTCATTTTTCATTCCCTTAACCATCATGGTGATCACCTACTTTCTAAC
TATCAAGTCACTCCAGAAAGAAGCTACTTTGTGTGTAAGTGATCTTGGCACACGGGCCAAATTAGCTTCT
TTCAGCTTCCTCCCTCAGAGTTCTTTGTCTTCAGAAAAGCTCTTCCAGCGGTCGATCCATAGGGAGCCAG
GGTCCTACACAGGCAGGAGGACTATGCAGTCCATCAGCAATGAGCAAAAGGCATGCAAGGTGCTGGGCAT
CGTCTTCTTCCTGTTTGTGGTGATGTGGTGCCCTTTCTTCATCACAAACATCATGGCCGTCATCTGCAAA
GAGTCCTGCAATGAGGATGTCATTGGGGCCCTGCTCAATGTGTTTGTTTGGATCGGTTATCTCTCTTCAG
CAGTCAACCCACTAGTCTACACACTGTTCAACAAGACCTATAGGTCAGCCTTTTCACGGTATATTCAGTG
TCAGTACAAGGAAAACAAAAAACCATTGCAGTTAATTTTAGTGAACACAATACCGGCTTTGGCCTACAAG
TCTAGCCAACTTCAAATGGGACAAAAAAAGAATTCAAAGCAAGATGCCAAGACAACAGATAATGACTGCT
CAATGGTTGCTCTAGGAAAGCAGCATTCTGAAGAGGCTTCTAAAGACAATAGCGACGGAGTGAATGAAAA
GGTGAGCTGTGTGTGA


Clone variation with respect to NM_000621.4
74:a=>c
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000621 unedited
GCANAANAGGGGACTCTACACCAGTTTAATTACTGTGAGAGATGCAGCGAGTCACAGAAT
AACAAATGTATCTCATGTGTGGACCCTGAAGACAAATGACATTTATCTTCCCGAGCGCTC
AAAAAAAACCCTGCAACCTCTATGCTAAAAGTTCATTCTGCTTTTTTGTCCTCGGTTTTT
TTTATTAAAATAATAAAACCAAACAGTGGACTCTCCTAAAATTGTGAATGAAGAAAACTT
ACAGCCACCACAGTTCAGTTCTTTAACTATCATTGTAATAATGGAAGACAAAAATCCAGC
CCCGGGAGAACAGCATGTACACCAGCCTCAGTGTTACAGAGTGTGGGTACATCAAGGTGA
ATGGTGAGCAGAAACTATAACCTGTTAGTCCTTCTACACCTCATCTGCTACAAGTTCTGG
CTTAGACATGGATATTCTTTGTGAAGAAAATACTTCTTTGAGCTCAACTACGAACTCCCT
AATGCAATTAAATGATGACAACAGGCTCTACAGTAATGACTTTAACTCCGGAGAAGCTAA
CACTTCTGATGCATTTAACTGGACAGTCGACTCTGAAAATCGAACCAACCTTTCCTGTGA
AGGGTGCCTCTCACCGTCGTGTCTCTCCTTACTTCATCTCCAGGAAAAAAACTGGTCTGC
TTTACTGACAGCCGTAGTGATTATTCTAACTATTGCTGNGAACATACTCGTCATCATGGC
AGTGTCCCTAGAGAAAAAGCTGCAGAATGCCACCAACTATTTCCTGATGTCACTTGCCAT
AGCTGATATGCTGCTGGGTTTCCTTGTCATGCCCGTGTCCATGTTAACCATCCTGTATGG
GTACCCGTGGCCTCTGCCGAGCAGCTTTGTGCAGTCTGGATT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000621 unedited
GCGGCACGCAATCTAGTATCGAGTTTTTTTTTTTTTTTTTTGTGATAGGGTCTCACTCTG
TTGCCCAGGAGGAAATGGCAGTGGTGTGAACTTGGCTCACTGCAGCCTTGAGCTTCTGGG
CTCAAGTGATCCTTGCGTCTCAGCCTCCCCTGTAGCTGGGACCACAGTTGTGTGCCACAA
GGATCAGATAATTTTTTGATTTTTTTTGTAGAGACAGGGAGGTCTCACTTTGTTACCCAG
GTTGGTCTCAAACTCTTGGCCTCAAGTGATCCTCCCATCTCAGCCTCCCAAAGTGCTAGG
ATTACATGCACGAGCCTCCGTGCCTGGCCGAGCCATTTCGTTTGAAGGCAAGGATTTTGT
TTTAATTATTTTTATATTTCTCATATCTAGAAATTTGCTTCACACATAAATGTACACTCA
ATAGATGATTGTGGAACCAAGCAGAATGGTTTTAATAAATAGTATAAACCGATGGATCTG
AAAGCATCAGTTTACCTGATGAGTGTCATAGGAAAGTCACCTGCTTTTTACAGAGATGTC
CTAAGACTCTACCACTGTCAGTAGCCGGAAACCTGAGTTCATCCTCAATCCTGACACAGT
TACATCAATATACATTTACTGCTCAAAAGAGTGCATGCATGATGCAGTCATTTCACAGCA
AGTTACCAAATACCTCGATAGTGCTGTTTTAGAAGAGCAATTGCTAGAAAAGCATTTGGT
AATGGTAAATCATCCTTTTGCTAGTTACCTAGAGGAACAATATTAAACNAGACACACTGG
AATTCAGAGTAAGCCCAGAAGTGAAGAGAAGCAGCATAGCTATGGATACATTTGAGTCTT
TTCACTCTGAGATTACTTGAATGCCCAATGCCACACCCTGGATATTTCAAATGTTCTATG
AAAACAGATGAAAATGGTGCAGTTTTATTAATATT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000621
ORF Size 1416 bp
Insert Size 3300
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_000621.2.
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000621.2, NP_000612
RefSeq Size 5442
RefSeq ORF 1416
Locus ID 3356
Cytogenetics 13q14.2
Domains 7tm_1
Protein Families GPCR, Transmembrane, Druggable Genome
Protein Pathways Calcium signaling pathway, Neuroactive ligand-receptor interaction, Gap junction
Gene Summary This gene encodes one of the receptors for serotonin, a neurotransmitter with many roles. Mutations in this gene are associated with susceptibility to schizophrenia and obsessive-compulsive disorder, and are also associated with response to the antidepressant citalopram in patients with major depressive disorder (MDD). MDD patients who also have a mutation in intron 2 of this gene show a significantly reduced response to citalopram as this antidepressant downregulates expression of this gene. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations