TGF beta 1(TGFB1) (NM_000660) Human Untagged Clone

CAT#: SC119746

TGFB1 (untagged)-Human transforming growth factor, beta 1 (TGFB1)

USD 196


Availability*
2 Weeks

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name TGF beta 1(TGFB1) (NM_000660) Human Untagged Clone
Symbol TGFB1
Synonyms CED; DPD1; LAP; TGFB; TGFbeta
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_000660 edited
GAATTCGGCACCAGGCGTCCCTCAGGCGCCCCCATTCCGGACCAGCCCTCGGGAGTCGCC
GACCCGGCCTCCCGCAAAGACTTTTCCCCAGACCTCGGGCGCACCCCCTGCACGCCGCCT
TCATCCCCGGCCTGTCTCCTGAGCCCCCGCGCATCCTAGACCCTTTCTCCTCCAGGAGAC
GGATCTCTCTCCGACCTGCCACAGATCCCCTATTCAAGACCACCCACCTTCTGGTACCAG
ATCGCGCCCATCTAGGTTATTTCCGTGGGATACTGAGACACCCCCGGTCCAAGCCTCCCC
TCCACCACTGCGCCCTTCTCCCTGAGGACCTCAGCTTTCCCTCGAGGCCCTCCTACCTTT
TGCCGGGAGACCCCCAGCCCCTGCAGGGGCGGGGCCTCCCCACCACACCAGCCCTGTTCG
CGCTCTCGGCAGTGCCGGGGGGCGCCGCCTCCCCCATGCCGCCCTCCGGGCTGCGGCTGC
TGCCGCTGCTGCTACCGCTGCTGTGGCTACTGGTGCTGACGCCTGGCCGGCCGGCCGCGG
GACTATCCACCTGCAAGACTATCGACATGGAGCTGGTGAAGCGGAAGCGCATCGAGGCCA
TCCGCGGCCAGATCCTGTCCAAGCTGCGGCTCGCCAGCCCCCCGAGCCAGGGGGAGGTGC
CGCCCGGCCCGCTGCCCGAGGCCGTGCTCGCCCTGTACAACAGCACCCGCGACCGGGTGG
CCGGGGAGAGTGCAGAACCGGAGCCCGAGCCTGAGGCCGACTACTACGCCAAGGAGGTCA
CCCGCGTGCTAATGGTGGAAACCCACAACGAAATCTATGACAAGTTCAAGCAGAGTACAC
ACAGCATATATATGTTCTTCAACACATCAGAGCTCCGAGAAGCGGTACCTGAACCCGTGT
TGCTCTCCCGGGCAGAGCTGCGTCTGCTGAGGCTCAAGTTAAAAGTGGAGCAGCACGTGG
AGCTGTACCAGAAATACAGCAACAATTCCTGGCGATACCTCAGCAACCGGCTGCTGGCAC
CCAGCGACTCGCCAGAGTGGTTATCTTTTGATGTCACCGGAGTTGTGCGGCAGTGGTTGA
GCCGTGGAGGGGAAATTGAGGGCTTTCGCCTTAGCGCCCACTGCTCCTGTGACAGCAGGG
ATAACACACTGCAAGTGGACATCAACGGGTTCACTACCGGCCGCCGAGGTGACCTGGCCA
CCATTCATGGCATGAACCGGCCTTTCCTGCTTCTCATGGCCACCCCGCTGGAGAGGGCCC
AGCATCTGCAAAGCTCCCGGCACCGCCGAGCCCTGGACACCAACTATTGCTTCAGCTCCA
CGGAGAAGAACTGCTGCGTGCGGCAGCTGTACATTGACTTCCGCAAGGACCTCGGCTGGA
AGTGGATCCACGAGCCCAAGGGCTACCATGCCAACTTCTGCCTCGGGCCCTGCCCCTACA
TTTGGAGCCTGGACACGCAGTACAGCAAGGTCCTGGCCCTGTACAACCAGCATAACCCGG
GCGCCTCGGCGGCGCCGTGCTGCGTGCCGCAGGCGCTGGAGCCGCTGCCCATCGTGTACT
ACGTGGGCCGCAAGCCCAAGGTGGAGCAGCTGTCCAACATGATCGTGCGCTCCTGCAAGT
GCAGCTGAGGTCCCGCCCCGCCCCGCCCCGCCCCGGCAGGCCCGGCCCCACCCCGCCCCG
CCCCCGCTGCCTTGCCCATGGGGGCTGTATTTAAGGACACCCGTGCCCCAAGCCCACCTG
GGGCCCCATTAAAGATGGAGAGAGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_000660 unedited
TAAGATTTGTAATACGACTCACTATAGGGCGGCCGCGNAATTCGCACCAGGCGTCCCTCA
GGCGCCCCCATTCCGGACCAGCCCTCGGGAGTCGCCGACCCGGCCTCCCGCAAAGACTTT
TCCCCAGACCTCGGGCGCACCCCCTGCACGCCGCCTTCATCCCCGGCCTGTCTCCTGAGC
CCCCGCGCATCCTAGACCCTTTCTCCTCCAGGAGACGGATCTCTCTCCGACCTGCCACAG
ATCCCCTATTCAAGACCACCCACCTTCTGGTACCAGATCGCGCCCATCTAGGTTATTTCC
GTGGGATACTGAGACACCCCCGGTCCAAGCCTCCCCTCCACCACTGCGCCCTTCTCCCTG
AGGACCTCAGCTTTCCCTCGAGGCCCTCCTACCTTTTGCCGGGAGACCCCCAGCCCCTGC
AGGGGCGGGGCCTCCCCACCACACCAGCCCTGTTCGCGCTCTCGGCAGTGCCGGGGGGCG
CCGCCTCCCCCATGCCGCCCTCCGGGCTGCGGCTGCTGCCGCTGCTGCTACCGCTGCTGT
GGCTACTGGTGCTGACGCCTGGCCGGCCGGCCGCGGGACTATCCACCTGCAAGACTATCG
ACATGGAGCTGGTGAAGCGGAAGCGCATCGAGGCCATCCGCGGCCAGATCCTGTCCAAGC
TGCGGCTCGCCAGCCCCCCGAGCCAGGGGGGAGGTGCCGCCCGGCCCGCTGCCCGAGGCC
GTGCTCGCCCTGTACAACAGCACCCGCGACCGGGTGGCCGGNGAGAGTGCANAACCGGAG
CCCGAGCCCTGAGCCGACTACTACGCCAAGGNAGTCACCCGCGTGCTAATGGGTGGAAAC
CCACANNCGAATCTATGACAGTCTCAGCAGAGTCACACAGCATATTATATGTTCTTCACA
CATCAGAGCTCCGAGAAGCGGACCTGAACCCCGTGTGCTCTCCCGGCAAAGCTGCGTCTG
CTGAGGCTCAGT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_000660 unedited
AACCGCGAAACCCACACTTTTNNNNNNGTTTACTTGAACCCGGCCGCAATCTANATCGAG
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTCTCTCCATCTTAA
AGGGGGCCCCAGGGGGGCTTGGGGCACGGGTGTCCTTAAAACACCCCCCATGGGCAAGGC
ACCGGGGGCGGGGCGGGGTGGGGCCGGCCCTGCCGGGGCGGGGCGGGGCGGGGCGGAACC
TCATTTGCACTTGCAGGAGCCCACAATCATGTTGGACAGCTGCTCCACCTTGGGCTTGCG
GCCCACGTATAACACAATGGGCAGGGGTTCCAGCGCCTGGGGAACCCAAAACGGCCCCCC
CGAGGCGCCCGGGTTATGCTGGTTGTACAGGGCCAGAACCTTGCTGTACTGCGTGTCCAG
CCTCCAAATGTAGGGGCAGGGCCCAAGGCAAAAGTTGGCATGGAACCCCTTGGGCTCGGG
GATCCACTTCCAGCCGAGGTCCTTGCGGAAGTAAATGTACAGCTGCCGAACCCAACAGTT
TTTTTCCGTGGAGCTAGAACAATATTTGGTGTCCAGGGCTCGGCGGTGCCGGAAGCTTTG
CAAATGCTGGGCCCCTCTCCAGCGGGGTGGCCATGAAAAACAAGAAAAGGCCGGTTATTG
CCATGAATGTTGGCCAGGTCACCTCGGCGGCCGGTAGTAAACCCTTTGATGTCCACTTGC
AGGGTGTATCCCTGCTGCAAAGAAACAGGGGCCCTTAAGGCAAAGCCCTCAATTTCCCCT
CCAGGGTAACCCATTGCGAAAATTTCGGGGAAATAAAAAAAACCCCTTTGGCAATCCTTG
GGGTCCACAAACCGGTTGTGAGGTATCCACAGAATTTTTTTTTTTTTTGGACAGCTCCCG
GCGGTCCCCTTTAACTGGAACCCAAAAAACCCACTTTTGCCGAAAAAACACGGTTTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_000660
ORF Size 1173 bp
Insert Size 1870
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation TRueClone
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_000660.3, NP_000651
RefSeq Size 2346
RefSeq ORF 1173
Locus ID 7040
Cytogenetics 19q13.2
Domains TGFb_propeptide, TGF-beta
Protein Families Secreted Protein, ES Cell Differentiation/IPS, Transcription Factors, Druggable Genome
Protein Pathways MAPK signaling pathway, Cytokine-cytokine receptor interaction, Cell cycle, TGF-beta signaling pathway, Pathways in cancer, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Chronic myeloid leukemia, Hypertrophic cardiomyopathy (HCM), Dilated cardiomyopathy
Gene Summary This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGFB family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. This gene is frequently upregulated in tumor cells, and mutations in this gene result in Camurati-Engelmann disease. [provided by RefSeq, Aug 2016].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations