ATP citrate lyase(ACLY) (NM_001096) Human Untagged Clone

CAT#: SC119485

ACLY (untagged)-Human ATP citrate lyase (ACLY), transcript variant 1

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name ATP citrate lyase(ACLY) (NM_001096) Human Untagged Clone
Symbol ACLY
Synonyms ACL; ATPCL; CLATP
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>NCBI ORF sequence for NM_001096, the custom clone sequence may differ by one or more nucleotides


ATGTCGGCCAAGGCAATTTCAGAGCAGACGGGCAAAGAACTCCTTTACAAGTTCATCTGTACCACCTCAG
CCATCCAGAATCGGTTCAAGTATGCTCGGGTCACTCCTGACACAGACTGGGCCCGCTTGCTGCAGGACCA
CCCCTGGCTGCTCAGCCAGAACTTGGTAGTCAAGCCAGACCAGCTGATCAAACGTCGTGGAAAACTTGGT
CTCGTTGGGGTCAACCTCACTCTGGATGGGGTCAAGTCCTGGCTGAAGCCACGGCTGGGACAGGAAGCCA
CAGTTGGCAAGGCCACAGGCTTCCTCAAGAACTTTCTGATCGAGCCCTTCGTCCCCCACAGTCAGGCTGA
GGAGTTCTATGTCTGCATCTATGCCACCCGAGAAGGGGACTACGTCCTGTTCCACCACGAGGGGGGTGTG
GACGTGGGTGATGTGGACGCCAAGGCCCAGAAGCTGCTTGTTGGCGTGGATGAGAAACTGAATCCTGAGG
ACATCAAAAAACACCTGTTGGTCCACGCCCCTGAAGACAAGAAAGAAATTCTGGCCAGTTTTATCTCCGG
CCTCTTCAATTTCTACGAGGACTTGTACTTCACCTACCTCGAGATCAATCCCCTTGTAGTGACCAAAGAT
GGAGTCTATGTCCTTGACTTGGCGGCCAAGGTGGACGCCACTGCCGACTACATCTGCAAAGTGAAGTGGG
GTGACATCGAGTTCCCTCCCCCCTTCGGGCGGGAGGCATATCCAGAGGAAGCCTACATTGCAGACCTCGA
TGCCAAAAGTGGGGCAAGCCTGAAGCTGACCTTGCTGAACCCCAAAGGGAGGATCTGGACCATGGTGGCC
GGGGGTGGCGCCTCTGTCGTGTACAGCGATACCATCTGTGATCTAGGGGGTGTCAACGAGCTGGCAAACT
ATGGGGAGTACTCAGGCGCCCCCAGCGAGCAGCAGACCTATGACTATGCCAAGACTATCCTCTCCCTCAT
GACCCGAGAGAAGCACCCAGATGGCAAGATCCTCATCATTGGAGGCAGCATCGCAAACTTCACCAACGTG
GCTGCCACGTTCAAGGGCATCGTGAGAGCAATTCGAGATTACCAGGGCCCCCTGAAGGAGCACGAAGTCA
CAATCTTTGTCCGAAGAGGTGGCCCCAACTATCAGGAGGGCTTACGGGTGATGGGAGAAGTCGGGAAGAC
CACTGGGATCCCCATCCATGTCTTTGGCACAGAGACTCACATGACGGCCATTGTGGGCATGGCCCTGGGC
CACCGGCCCATCCCCAACCAGCCACCCACAGCGGCCCACACTGCAAACTTCCTCCTCAACGCCAGCGGGA
GCACATCGACGCCAGCCCCCAGCAGGACAGCATCTTTTTCTGAGTCCAGGGCCGATGAGGTGGCGCCTGC
AAAGAAGGCCAAGCCTGCCATGCCACAAGATTCAGTCCCAAGTCCAAGATCCCTGCAAGGAAAGAGCACC
ACCCTCTTCAGCCGCCACACCAAGGCCATTGTGTGGGGCATGCAGACCCGGGCCGTGCAAGGCATGCTGG
ACTTTGACTATGTCTGCTCCCGAGACGAGCCCTCAGTGGCTGCCATGGTCTACCCTTTCACTGGGGACCA
CAAGCAGAAGTTTTACTGGGGGCACAAAGAGATCCTGATCCCTGTCTTCAAGAACATGGCTGATGCCATG
AGGAAGCATCCGGAGGTAGATGTGCTCATCAACTTTGCCTCTCTCCGCTCTGCCTATGACAGCACCATGG
AGACCATGAACTATGCCCAGATCCGGACCATCGCCATCATAGCTGAAGGCATCCCTGAGGCCCTCACGAG
AAAGCTGATCAAGAAGGCGGACCAGAAGGGAGTGACCATCATCGGACCTGCCACTGTTGGAGGCATCAAG
CCTGGGTGCTTTAAGATTGGCAACACAGGTGGGATGCTGGACAACATCCTGGCCTCCAAACTGTACCGCC
CAGGCAGCGTGGCCTATGTCTCACGTTCCGGAGGCATGTCCAACGAGCTCAACAATATCATCTCTCGGAC
CACGGATGGCGTCTATGAGGGCGTGGCCATTGGTGGGGACAGGTACCCGGGCTCCACATTCATGGATCAT
GTGTTACGCTATCAGGACACTCCAGGAGTCAAAATGATTGTGGTTCTTGGAGAGATTGGGGGCACTGAGG
AATATAAGATTTGCCGGGGCATCAAGGAGGGCCGCCTCACTAAGCCCATCGTCTGCTGGTGCATCGGGAC
GTGTGCCACCATGTTCTCCTCTGAGGTCCAGTTTGGCCATGCTGGAGCTTGTGCCAACCAGGCTTCTGAA
ACTGCAGTAGCCAAGAACCAGGCTTTGAAGGAAGCAGGAGTGTTTGTGCCCCGGAGCTTTGATGAGCTTG
GAGAGATCATCCAGTCTGTATACGAAGATCTCGTGGCCAATGGAGTCATTGTACCTGCCCAGGAGGTGCC
GCCCCCAACCGTGCCCATGGACTACTCCTGGGCCAGGGAGCTTGGTTTGATCCGCAAACCTGCCTCGTTC
ATGACCAGCATCTGCGATGAGCGAGGACAGGAGCTCATCTACGCGGGCATGCCCATCACTGAGGTCTTCA
AGGAAGAGATGGGCATTGGCGGGGTCCTCGGCCTCCTCTGGTTCCAGAAAAGGTTGCCTAAGTACTCTTG
CCAGTTCATTGAGATGTGTCTGATGGTGACAGCTGATCACGGGCCAGCCGTCTCTGGAGCCCACAACACC
ATCATTTGTGCGCGAGCTGGGAAAGACCTGGTCTCCAGCCTCACCTCGGGGCTGCTCACCATCGGGGATC
GGTTTGGGGGTGCCTTGGATGCAGCAGCCAAGATGTTCAGTAAAGCCTTTGACAGTGGCATTATCCCCAT
GGAGTTTGTGAACAAGATGAAGAAGGAAGGGAAGCTGATCATGGGCATTGGTCACCGAGTGAAGTCGATA
AACAACCCAGACATGCGAGTGCAGATCCTCAAAGATTACGTCAGGCAGCACTTCCCTGCCACTCCTCTGC
TCGATTATGCACTGGAAGTAGAGAAGATTACCACCTCGAAGAAGCCAAATCTTATCCTGAATGTAGATGG
TCTCATCGGAGTCGCATTTGTAGACATGCTTAGAAACTGTGGGTCCTTTACTCGGGAGGAAGCTGATGAA
TATATTGACATTGGAGCCCTCAATGGCATCTTTGTGCTGGGAAGGAGTATGGGGTTCATTGGACACTATC
TTGATCAGAAGAGGCTGAAGCAGGGGCTGTATCGTCATCCGTGGGATGATATTTCATATGTTCTTCCGGA
ACACATGAGCATGTAA


5' Read Nucleotide Sequence
>OriGene 5' read for NM_001096 unedited
AGTATATTTGTATACGACTCACTATAGGGCGGCNCGCGAATTCGCACCAGCCGGATTTTG
CGGGGTTCGTCGGGCCTGTGGAAGAAGCGCCGCGCACGGACTTCGGCAGAGGTAGAGCAG
GTCTCTCTGCAGCCATGTCGGCCAAGGCAATTTCAGAGCAGACGGGCAAAGAACTCCTTT
ACAAGTTCATCTGTACCACCTCAGCCATCCAGAATCGGTTCAAGTATGCTCGGGTCACTC
CTGACACAGACTGGGCCCGCTTGCTGCAGGACCACCCCTGGCTGCTCAGCCAGAACTTGG
TAGTCAAGCCAGACCAGCTGATCAAACGTCGTGGAAAACTTGGTCTCGTTGGGGTCAACC
TCACTCTGGATGGGGTCAAGTCCTGGCTGAAGCCACGGCTGGGACAGGAAGCCACAGTTG
GCAAGGCCACAGGCTTCCTCAAGAACTTTCTGATCGAGCCCTTCGTCCCCCACAGTCAGG
CTGAGGAGTTCTATGTCTGCATCTATGCCACCCGAGAAGGGGACTACGTCCTGTTCCACC
ACGAGGGGGGTGTGGACGTGGGTGATGTGGACGCCAAGGCCCAGAAGCTGCTTGTTGGCG
TGGATGAGAAACTGAATCCTGAGGACATCAAAAAACACCTGTTGGTCCACGCCCCTGAAG
ACAAGAAAGAAATTCTGGCCAGTTTTATCTCCGGCCTCTTCAATTTCTACGAGGACTTGT
ACTTCACCTACCTCGAGATCAATCCCCTTGTAGTGACCAAAGATGAAGTCTATGTCCTTG
ACTTGGCGGCCAAAGTGGACGCCACTGCCGACTACATCTGCANAGTGAAAGTGGGGTGAC
ATCGAGTTCCCTTCCCCCTCTCGGCGGGAGGCATATCCAGAGGAAGCCTACCATGCAGAC
CCGATGCCAAAAGTGGGACAGCCCTGAGCTGACCTGCTTGAACCCAAGGNAGATCTGNAC
CATGTGGCCG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001096 unedited
NNCATGCTGCCCGCGGCCGCATTCTANATCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTGCCTTCATTGGTACTATATAGTTTATTTAAACCCGACTATGATAATAC
CGAAAAAAAACTGGGGGGGCAGCTGCCCAAAATCTTTGGGGATTACAGATGCAAAGTAGT
TAGGAGTCCTTGGACCCACACTTTAGTTACAGACAGACAAATCAGCTGCCTAAATACCGA
GAACATAAGACACAAGACATTTCACAGCTTTCTGCATTTCCATTTTAAATGGATGGATGT
TACAACTTTACATATTAAGTTACTACTCCACATATTTTGGGACAATGGCTAAGGATGCAA
TGGCCCCATCCCCCTGACATAAACAAACTTTGGTCTGCAACACAAAACATTTCAGTGGGA
TACCAAACAAGCCCTTAACACGTAACATACCAAAAGATCTTTAAAAATCAAATTAATACA
ATGTTTTTCATGGTATATAAGGAAAAAAAAAGGGAAGTAAAAAAAAAAAAAGAGAGACAT
TGGGGGGCTTTAAATGGATAGGATCTTGAGGGCATAAATGGTTCATTCCCTTCCTCCAAG
GGGAAAAAATGTTTAACTAATGGAATAAAAAAGCAACATCCTAACCCCTTCAATGAGGAA
AACCCCCTCCTTGCAGTCCTTAAAAGCCTTCCACATTAAAAAATCCCCACGGCGACCACA
GCAAAAGCCCAAAATATTGGGCTTGGGGTTTTTATTCTCTTGCCTTATATACAAAAATAA
TGTAACTTTCTTTTTGNGGGCCTCGAAGGGCGCTCACCCCTGAGATAGTCGGTCTTCTGG
GCCCTGACCCCCATAGCGTTGGTACACATTTCAGGCCCCTTGCATAACAAACACAGCACT
CCCCCGCACCATTTATCTCATATCCTTTTTCTTTCGGTGAAACACAGCCTCTCTTTT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001096
ORF Size 3306 bp
Insert Size 4780
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001096.2, NP_001087
RefSeq Size 4450
Locus ID 47
Cytogenetics 17q21.2
Domains CoA_binding, ligase-CoA
Protein Families Druggable Genome
Protein Pathways Citrate cycle (TCA cycle), Metabolic pathways
Gene Summary ATP citrate lyase is the primary enzyme responsible for the synthesis of cytosolic acetyl-CoA in many tissues. The enzyme is a tetramer (relative molecular weight approximately 440,000) of apparently identical subunits. It catalyzes the formation of acetyl-CoA and oxaloacetate from citrate and CoA with a concomitant hydrolysis of ATP to ADP and phosphate. The product, acetyl-CoA, serves several important biosynthetic pathways, including lipogenesis and cholesterogenesis. In nervous tissue, ATP citrate-lyase may be involved in the biosynthesis of acetylcholine. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Dec 2014].
Transcript Variant: This variant (1) has an alternate splice site, which results in translation initiation at a downstream AUG start codon, compared to variant 3. The resulting isoform (1) is shorter at the N-terminus, compared to isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations