XIAP (NM_001167) Human Untagged Clone

CAT#: SC119404

XIAP (untagged)-Human X-linked inhibitor of apoptosis (XIAP), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name XIAP (NM_001167) Human Untagged Clone
Symbol XIAP
Synonyms API3; BIRC4; hIAP-3; hIAP3; IAP-3; ILP1; MIHA; XLP2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC119404 sequence for NM_001167 edited (data generated by NextGen Sequencing)
ATGACTTTTAACAGTTTTGAAGGATCTAAAACTTGTGTACCTGCAGACATCAATAAGGAA
GAAGAATTTGTAGAAGAGTTTAATAGATTAAAAACTTTTGCTAATTTTCCAAGTGGTAGT
CCTGTTTCAGCATCAACACTGGCACGAGCAGGGTTTCTTTATACTGGTGAAGGAGATACC
GTGCGGTGCTTTAGTTGTCATGCAGCTGTAGATAGATGGCAATATGGAGACTCAGCAGTT
GGAAGACACAGGAAAGTATCCCCAAATTGCAGATTTATCAACGGCTTTTATCTTGAAAAT
AGTGCCACGCAGTCTACAAATTCTGGTATCCAGAATGGTCAGTACAAAGTTGAAAACTAT
CTGGGAAGCAGAGATCATTTTGCCTTAGACAGGCCATCTGAGACACATGCAGACTATCTT
TTGAGAACTGGGCAGGTTGTAGATATATCAGACACCATATACCCGAGGAACCCTGCCATG
TATAGTGAAGAAGCTAGATTAAAGTCCTTTCAGAACTGGCCAGACTATGCTCACCTAACC
CCAAGAGAGTTAGCAAGTGCTGGACTCTACTACACAGGTATTGGTGACCAAGTGCAGTGC
TTTTGTTGTGGTGGAAAACTGAAAAATTGGGAACCTTGTGATCGTGCCTGGTCAGAACAC
AGGCGACACTTTCCTAATTGCTTCTTTGTTTTGGGCCGGAATCTTAATATTCGAAGTGAA
TCTGATGCTGTGAGTTCTGATAGGAATTTCCCAAATTCAACAAATCTTCCAAGAAATCCA
TCCATGGCAGATTATGAAGCACGGATCTTTACTTTTGGGACATGGATATACTCAGTTAAC
AAGGAGCAGCTTGCAAGAGCTGGATTTTATGCTTTAGGTGAAGGTGATAAAGTAAAGTGC
TTTCACTGTGGAGGAGGGCTAACTGATTGGAAGCCCAGTGAAGACCCTTGGGAACAACAT
GCTAAATGGTATCCAGGGTGCAAATATCTGTTAGAACAGAAGGGACAAGAATATATAAAC
AATATTCATTTAACTCATTCACTTGAGGAGTGTCTGGTAAGAACTACTGAGAAAACACCA
TCACTAACTAGAAGAATTGATGATACCATCTTCCAAAATCCTATGGTACAAGAAGCTATA
CGAATGGGGTTCAGTTTCAAGGACATTAAGAAAATAATGGAGGAAAAAATTCAGATATCT
GGGAGCAACTATAAATCACTTGAGGTTCTGGTTGCAGATCTAGTGAATGCTCAGAAAGAC
AGTATGCAAGATGAGTCAAGTCAGACTTCATTACAGAAAGAGATTAGTACTGAAGAGCAG
CTAAGGCGCCTGCAAGAGGAGAAGCTTTGCAAAATCTGTATGGATAGAAATATTGCTATC
GTTTTTGTTCCTTGTGGACATCTAGTCACTTGTAAACAATGTGCTGAAGCAGTTGACAAG
TGTCCCATGTGCTACACAGTCATTACTTTCAAGCAAAAAATTTTTATGTCTTAA

Clone variation with respect to NM_001167.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001167 unedited
GGTAGGATTTTGTAACACGATTTCACTATAGGGCGGCCGCGAATTCGCACGAGGCCAAGC
CGTAGAGCGGAGTTGGCATTTCCAGATTGGGGCTCGGGCCGCGCCTCCTCCGGGACCCTC
CCCTTGGACCGAGCCGATCGCCGCGGGGCAGTTCGGGCCGGCTGTCCTGGCGCGAAAAGG
TGGACAAGTCCTATTTTCAAGAGAAGATGACTTTTAACAGTTTTGAAGGATCTAAAACTT
GTGTACCTGCAGACATCAATAAGGAAGAAGAATTTGTAGAAGAGTTTAATAGATTAAAAA
CTTTTGCTAATTTTCCAAGTGGTAGTCCTGTTTCAGCATCAACACTGGCACGAGCAGGGT
TTCTTTATACTGGTGAAGGAGATACCGTGCGGTGCTTTAGTTGTCATGCAGCTGTAGATA
GATGGCAATATGGAGACTCAGCAGTTGGAAGACACAGGAAAGTATCCCCAAATTGCAGAT
TTATCAACGGCTTTTATCTTGAAAATAGTGCCACGCAGTCTACAAATTCTGGTATCCAGA
ATGGTCAGTACAAAGTTGAAAACTATCTGGGAAGCAGAGATCATTTTGCCTTAGACAGGC
CATCTGAGACACATGCAGACTATCTTTTGAGAACTGNGCAGGTTGTAGATATATCAGACA
CCATATACCCGAGGAACCCTGCCATGTATAGTGAAGAAGCTAGATTAAAAGTCCTTTCAG
AACTGCCCAGACTATGCTCACCTAACCCCAGAGAGTTAGCCAGTGCTGGACTCTACTACA
CAGGTATTGGTGACCAAGTGCAGTGCTTTTTGTTGTGGTGGAAAACTGAAAAAATGGGAA
CCTGTGATCGTGCCTTGGTCAGACACAAGCGACACTTNTCCTAATTGCTTCTTTGGTTGG
GGCCNGNATTCTTATATTCGAATGAAATTGAGGCTGGGAGGTCTGATG
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001167 unedited
CGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTAAGGATCTTGAGAGAACAT
TTATTTCAGAAGTATCTACTACTATTACTAGCCAAGAAAACAAATGTAGGTAGAGGAAAG
ACTTAACATTTTGTCCTATATACATCTTAATCATCCTAATGGTAAAAACTCACATGAAAC
TTTAAGATACAAGATGATATGAGAATCTCAACATGGAAAGCTGTCACTATAACTACAAGC
AGTGTACAAACATGCTTCTACTTTTACCTACATAAGCTGACAGATGTTTAAAATACTGAG
TTAACAAAGATCTTTTAGTAAAGTGACTTAGGCAGGCTTAAACTAGCAAGGATTAAGGAT
GAATCCTTACTAATTAATTGGAAGATCTGAGACATATTTTATATTTCATTTTACAAAATC
AGAAATACTTATTTTGAAACAAGATAAGACATGGTCTACCTGTCAAAAAACTACCACTCA
GAAATATTTTTCATCCACAAAGCAGGAAAAACATAAAATCATTTACATTTCACATTGGCA
CCAAAAAGGTTAACTGCCCTGCCTTCTTGGATTAGAAAAACTAAAGCTGAGTGATAAGTA
GTTTTGCAGGCGTTTGAACATGCCTAAGCCTTTAAATCAGCAAAATACTTTCTAAAAATT
CTGATTACAAAAGTAATACATACTTATAAAAAATTCGAACAGAACAAAATGAAAAAAGTA
GAAGGTGGAAAAGGGCCCCTATAAAACCCCTATGGNGCCCTTTCCCCCCAATTCCCNCCC
TTCCCGGAAGAGAAACCACATTTTACAGNNTTGGTGTATATCTTTCCAAATCTTTTGNTC
TATGCATATTAAAACATACATACTTTGATCTGGCTAGACTTACATAGTGNNTTGCCACTG
CATTTACACTTAACATATCTTGACATCTTCATGTAGTACATGTGGCTCGATAGATCTATC
ATAATACGCTTCAAAATGCAATACC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001167
ORF Size 1494 bp
Insert Size 3000
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001167.2, NP_001158
RefSeq Size 8413
RefSeq ORF 1494
Locus ID 331
Cytogenetics Xq25
Domains BIR, RING
Protein Families Druggable Genome
Protein Pathways Ubiquitin mediated proteolysis, Apoptosis, Focal adhesion, NOD-like receptor signaling pathway, Pathways in cancer, Small cell lung cancer
Gene Summary This gene encodes a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. This protein functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. This protein also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 2 and 11.[provided by RefSeq, Feb 2011].
Transcript Variant: This variant (1) represents the longest transcript. Both variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations