HIF-1 alpha(HIF1A) (NM_001530) Human Untagged Clone

CAT#: SC119189

HIF1A (untagged)-Human hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor) (HIF1A), transcript variant 1

USD 505.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name HIF-1 alpha(HIF1A) (NM_001530) Human Untagged Clone
Symbol HIF1A
Synonyms bHLHe78; HIF-1-alpha; HIF-1A; HIF-1alpha; HIF1; HIF1-ALPHA; MOP1; PASD8
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_001530 edited
GAATTCGGCACGAGGCCTCTTCGTCGCTTCGGCCAGTGTGTCGGGCTGGGCCCTGACAAG
CCACCTGAGGAGAGGCTCGGAGCCGGGCCCGGACCCCGGCGATTGCCGCCCGCTTCTCTC
TAGTCTCACGAGGGGTTTCCCGCCTCGCACCCCCACCTCTGGACTTGCCTTTCCTTCTCT
TCTCCGCGTGTGGAGGGAGCCAGCGCTTAGGCCGGAGCGAGCCTGGGGGCCGCCCGCCGT
GAAGACATCGCGGGGACCGATTCACCATGGAGGGCGCCGGCGGCGCGAACGACAAGAAAA
AGATAAGTTCTGAACGTCGAAAAGAAAAGTCTCGAGATGCAGCCAGATCTCGGCGAAGTA
AAGAATCTGAAGTTTTTTATGAGCTTGCTCATCAGTTGCCACTTCCACATAATGTGAGTT
CGCATCTTGATAAGGCCTCTGTGATGAGGCTTACCATCAGCTATTTGCGTGTGAGGAAAC
TTCTGGATGCTGGTGATTTGGATATTGAAGATGACATGAAAGCACAGATGAATTGCTTTT
ATTTGAAAGCCTTGGATGGTTTTGTTATGGTTCTCACAGATGATGGTGACATGATTTACA
TTTCTGATAATGTGAACAAATACATGGGATTAACTCAGTTTGAACTAACTGGACACAGTG
TGTTTGATTTTACTCATCCATGTGACCATGAGGAAATGAGAGAAATGCTTACACACAGAA
ATGGCCTTGTGAAAAAGGGTAAAGAACAAAACACACAGCGAAGCTTTTTTCTCAGAATGA
AGTGTACCCTAACTAGCCGAGGAAGAACTATGAACATAAAGTCTGCAACATGGAAGGTAT
TGCACTGCACAGGCCACATTCACGTATATGATACCAACAGTAACCAACCTCAGTGTGGGT
ATAAGAAACCACCTATGACCTGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAA
ATATTGAAATTCCTTTAGATAGCAAGACTTTCCTCAGTCGACACAGCCTGGATATGAAAT
TTTCTTATTGTGATGAAAGAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAG
GCCGCTCAATTTATGAATATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATC
ATGATATGTTTACTAAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAG
GTGGATATGTCTGGGTTGAAACTCAAGCAACTGTCATATATAACACCAAGAATTCTCAAC
CACAGTGCATTGTATGTGTGAATTACGTTGTGAGTGGTATTATTCAGCACGACTTGATTT
TCTCCCTTCAACAAACAGAATGTGTCCTTAAACCGGTTGAATCTTCAGATATGAAAATGA
CTCAGCTATTCACCAAAGTTGAATCAGAAGATACAAGTAGCCTCTTTGACAAACTTAAGA
AGGAACCTGATGCTTTAACTTTGCTGGCCCCAGCCGCTGGAGACACAATCATATCTTTAG
ATTTTGGCAGCAACGACACAGAAACTGATGACCAGCAACTTGAGGAAGTACCATTATATA
ATGATGTAATGCTCCCCTCACCCAACGAAAAATTACAGAATATAAATTTGGCAATGTCTC
CATTACCCACCGCTGAAACGCCAAAGCCACTTCGAAGTAGTGCTGACCCTGCACTCAATC
AAGAAGTTGCATTAAAATTAGAACCAAATCCAGAGTCACTGGAACTTTCTTTTACCATGC
CCCAGATTCAGGATCAGACACCTAGTCCTTCCGATGGAAGCACTAGACAAAGTTCACCTG
AGCCTAATAGTCCCAGTGAATATTGTTTTTATGTGGATAGTGATATGGTCAATGAATTCA
AGTTGGAATTGGTAGAAAAACTTTTTGCTGAAGACACAGAAGCAAAGAACCCATTTTCTA
CTCAGGACACAGATTTAGACTTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACT
TCCAGTTACGTTCCTTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAA
GCGCAAGTCCTCAAAGCACAGTTACAGTATTCCAGCAGACTCAAATACAAGAACCTACTG
CTAATGCCACCACTACCACTGCCACCACTGATGAATTAAAAACAGTGACAAAAGACCGTA
TGGAAGACATTAAAATATTGATTGCATCTCCATCTCCTACCCACATACATAAAGAAACTA
CTAGTGCCACATCATCACCATATAGAGATACTCAAAGTCGGACAGCCTCACCAAACAGAG
CAGGAAAAGGAGTCATAGAACAGACAGAAAAATCTCATCCAAGAAGCCCTAACGTGTTAT
CTGTCGCTTTGAGTCAAAGAACTACAGTTCCTGAGGAAGAACTAAATCCAAAGATACTAG
CTTTGCAGAATGCTCAGAGAAAGCGAAAAATGGAACATGATGGTTCACTTTTTCAAGCAG
TAGGAATTGGAACATTATTACAGCAGCCAGACGATCATGCAGCTACTACATCACTTTCTT
GGAAACGTGTAAAAGGATGCAAATCTAGTGAACAGAATGGAATGGAGCAAAAGACAATTA
TTTTAATACCCTCTGATTTAGCATGTAGACTGCTGGGGCAATCAATGGATGAAAGTGGAT
TACCACAGCTGACCAGTTATGATTGTGAAGTTAATGCTCCTATACAAGGCAGCAGAAACC
TACTGCAGGGTGAAGAATTACTCAGAGCTTTGGATCAAGTTAACTGAGCTTTTTCTTAAT
TTCATTCCTTTTTTTGGACACTGGTGGCTCACTACCTAAAGCAGTCTATTTATATTTTCT
ACATCTAATTTTAGAAGCCTGGCTACAATACTGCACAAACTTGGTTAGTTCAATTTTTGA
TCCCCTTTCTACTTAATTTACATTAATGCTCTTTTTTAGTATGTTCTTTAATGCTGGATC
ACAGACAGCTCATTTTCTCAGTTTTTTGGTATTTAAACCATTGCATTGCAGTAGCATCAT
TTXXXXXXXXXXXXCTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001530 unedited
AGTATTTTGTAATACGACTCACTTATAGGGCGGCCGCGAATCGGCACGAGGCCTCTTCGT
CGCTTCGGCCAGTGTGTCGGGCTGGGCCCTGACAAGCCACCTGAGGAGAGGCTCGGAGCC
GGGCCCGGACCCCGGCGATTGCCGCCCGCTTCTCTCTAGTCTCACGAGGGGTTTCCCGCC
TCGCACCCCCACCTCTGGACTTGCCTTTCCTTCTCTTCTCCGCGTGTGGAGGGAGCCAGC
GCTTAGGCCGGAGCGAGCCTGGGGGCCGCCCGCCGTGAAGACATCGCGGGGACCGATTCA
CCATGGAGGGCGCCGGCGGCGCGAACGACAAGAAAAAGATAAGTTCTGAACGTCGAAAAG
AAAAGTCTCGAGATGCAGCCAGATCTCGGCGAAGTAAAGAATCTGAAGTTTTTTATGAGC
TTGCTCATCAGTTGCCACTTCCACATAATGTGAGTTCGCATCTTGATAAGGCCTCTGTGA
TGAGGCTTACCATCAGCTATTTGCGTGTGAGGAAACTTCTGGATGCTGGTGATTTGGATA
TTGAAGATGACATGAAAGCACAGATGAATTGCTTTTATTTGAAAGCCTTGGATGGTTTTG
TTATGGTTCTCACAGATGATGGTGACATGATTTACATTTCTGATAATGTGAACAAATACA
TGGGATTAACTCAGTTTGAACTAACTGGACACAGTGGTGTTTGATTTTACTCATCCATGT
GACCATGAGGAAATGAGAGAAATGCTTACACACAGAAATGGCCTTGTGAAAAAGGGTANA
GAACANAACACACAGCGAAGCTTTNTTCTCAGAATGAAGTGTACCCTAACTAGCCCGAGG
AGAACTATGAACATAAAGTCTGCACCTTGGAAGGTATTGCACTGACAGGCCACATTCACG
TATATGATACCACAGTACCACCTCCATGTGGGGTATAAGAACCACTAGACCGGCTGGGGC
GCTGGATT
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001530 unedited
CGCGGCCCGCATTCTAANATCGAGTTTTTTTTTTTTTTTTTTTTTTTTCCTGGTTTTAAA
AAAGTTTATTTGATGGAACAAAACAATACAGTTAGTGTTAGATCCAACCACAAAGAGCAA
AAGGAATGAAAAATTTGTACAATGTACATAGAAAAAAACAAGATATTTACTGTGACAACT
ATATATTCCTAAAATAATGCTTCTAAATTTTTTCAATTATTGAAATCTACATGGGGAAAA
GGATGTTAATAGCGACAAAGTGCATAAAATCAAACATTGTATTTTGAGCAAATTAACATA
CTAGGCAATTTTGCTAAAAATGCATGATTTTTTTTTTCTTGTTTACAGCCTGCTCAAAAT
ATCTTTATACCAACAGGGTAGGCACAACATTTAGGTTTAATATCAGTTACACAATATTAG
CATAAACTTTCACAACTACATAGGGTATTGCCCTCTTTTGACCTGGCAAAGTGACTATAC
AAACATTATATGATTCCTCTGAATTGACAATTTCATCCAAATAAATGCCACATACCTTGT
ACATATATGCATATCTTCCTATATTATGCAAATGGCTTTACTCTTTAAAAATTAACCATG
CATGATACAACAATCATTATCCTCCGATTAACACTGTGCTGCGGCAGCGTCAACACTCGT
GCTGGCCCAAGAAAAACTTTCGAGCTAAAAACTGTTCTATCAACCCATAATATGTCTCAT
GAGCCACTGTTGGTCTTCTCTAATAAAAACTCTTGTGCAATGGGGGCTACCACACCCTGT
TGGCAAACGCCCTTATCTACGCACAAGGGGAAAAAAAGGGGGAAAAATTGCCAACGGCCT
TTATTTTTATCAAAGTATTGGCCTATTAAAAAATATTTGGACTTTTCTAAAATATTCGAA
AAGGATAACCTCCCTTCCAAAAAAATAAAAAGGGGCAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001530
ORF Size 2481 bp
Insert Size 4000
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001530.2, NP_001521
RefSeq Size 3958
Locus ID 3091
Cytogenetics 14q23.2
Domains PAS, HLH, PAC
Protein Families Transcription Factors
Protein Pathways mTOR signaling pathway, Pathways in cancer, Renal cell carcinoma
Gene Summary This gene encodes the alpha subunit of transcription factor hypoxia-inducible factor-1 (HIF-1), which is a heterodimer composed of an alpha and a beta subunit. HIF-1 functions as a master regulator of cellular and systemic homeostatic response to hypoxia by activating transcription of many genes, including those involved in energy metabolism, angiogenesis, apoptosis, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF-1 thus plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2011].
Transcript Variant: This variant (1) represents the predominant transcript, and encodes isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations