Cyclin D1 (CCND1) (NM_053056) Human Untagged Clone

USD 310.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name Cyclin D1 (CCND1) (NM_053056) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol CCND1
Synonyms BCL1; D11S287E; PRAD1; U21B31
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF within SC119035 sequence for NM_053056 edited (data generated by NextGen Sequencing)
ATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCGCGCGTACCCCGATGCC
AACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCGGAGGAGACCTGCGCGCCC
TCGGTGTCCTACTTCAAATGTGTGCAGAAGGAGGTCCTGCCGTCCATGCGGAAGATCGTC
GCCACCTGGATGCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGAGGAGGTCTTCCCGCTG
GCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAG
CTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACG
GCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATG
GAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTC
ATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAA
CACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCC
TCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCC
AACAACTTCCTGTCCTACTACCGCCTCACACGCTTCCTCTCCAGAGTGATCAAGTGTGAC
CCAGACTGCCTCCGGGCCTGCCAGGAGCAGATCGAAGCCCTGCTGGAGTCAAGCCTGCGC
CAGGCCCAGCAGAACATGGACCCCAAGGCCGCCGAGGAGGAGGAAGAGGAGGAGGAGGAG
GTGGACCTGGCTTGCACACCCACCGACGTGCGGGACGTGGACATCTGA

Clone variation with respect to NM_053056.2
723 g=>a
>OriGene 5' read for NM_053056 unedited
GTTCACATTTTGTATACGACTCACTATAGGCGGCCGCGAATCGGCACGAGGCGCAGTAGC
AGCGAGCAGCAGAGTCCGCACGCTCCGGCGAGGGGCAGAAGAGCGCGAGGGAGCGCGGGG
CAGCAGAAGCGAGAGCCGAGCGCGGACCCAGCCAGGACCCACAGCCCTCCCCAGCTGCCC
AGGAAGAGCCCCAGCCATGGAACACCAGCTCCTGTGCTGCGAAGTGGAAACCATCCGCCG
CGCGTACCCCGATGCCAACCTCCTCAACGACCGGGTGCTGCGGGCCATGCTGAAGGCGGA
GGAGACCTGCGCGCCCTCGGTGTCCTACTTCAAATGTGTGCAGAAGGAGGTCCTGCCGTC
CATGCGGAAGATCGTCGCCACCTGGATGCTGGAGGTCTGCGAGGAACAGAAGTGCGAGGA
GGAGGTCTTCCCGCTGGCCATGAACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAA
AAAGAGCCGCCTGCAGCTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGA
GACCATCCCCCTGACGGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGA
GGAGCTGCTGCAAATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGCCCGCAAT
GACCCCGCACGATTTCATTGAACACTTCCTCTCCAAAAGCCAGAAGCGGAGGAGAACANA
CAGATCATCCGCAAACACGCGCAGACCCTTCGTGCCCTCTGTGCACAGATGTGAAGTTCA
TTTCCATCCGCCCTCCATGTTGCANCGGCGAGCGTGGTGGCCGCACTGCAAGCCTGAACT
TGAGAAGCCCAACAACTTCCTGTCTACTACGGCCTAAAACGTTTCTCTCCAGAGTGATCA
AGGGGGACCCAAACTGCCTTC
>OriGene 3' read for NM_053056 unedited
CCGCGGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTACATAGCCAAGATGTG
CAAATTGTCTATTTTGTCACTAAGTTTTTTAAAGGAAGGGGCAGGGGATAAGAATTCATC
GGAACCGAACTTAGGTTGAGTACCCTAATTTTCCTTGCACCCATGCCTGTCCAATCAGAT
GACTCTGGGAAACGCCAAACAGGCTGAATCAATGTCTTTGTGTGGTTTTTTTCTTCCAGA
TTGTTTTTTTCTCACCTATAAAAGGATCTATCTTTAAAAATAAACTGTATTAAATCTGTA
ACATCAAAGGCAGAAGGTTTGTGTGTGTGTGTGTGTGTGTGTGTGTATCTGTGTGTTTAA
ATCAAGGGGAGATTGCATTTATAAATCATACTGGCCTTATGAACATCCTCTGCAATAAAT
ATACTTTTTAGCCTTAACTATAAATTATATATTTTAGTGTTTAAAAACCTTCCGGTGTGA
AACATCTAAGATAACCCTTAAAAACCACCTGTTCTCTAGGTAAACCTCTGAGGTCCCTAC
TTTCAAACACCAGTTGGCACCAAAGGATTCCTAAACTTCAACTTCTTTAAAGAAAAGGAA
AGGAACTTATCATCCTGGCAATGTGAGAATGCAAACCTTTTTCTTCTTGACTGGCACGCA
GCCTCCCAAACACCCCACCTTCACTGCCACACAGTGGCCCACACTTGCCTCAAAGTCTGC
TTGCAAACCAGACATGGATATTCCAAACCTTTCCATTAAAAACTGCCCTCCTTGCACACC
AACAAAAACAGCGTTATTTCCTCCACCTATTGTACTGAAATGCCTTGAAATGGAATGGTT
TTATATTTGAACAAGAACCACAACCAGTTCCTGTGGGTTAACCCTGACACTAACCTGCTG
CAGGGCCCTTGGTATAAAACCAACTTTTTTAAAGGTGTCTTCANAATTGGAAAGTTAAAA
ATAT
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_053056
Insert Size 2880 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_053056.1, NP_444284.1
RefSeq Size 4306 bp
RefSeq ORF 888 bp
Locus ID 595
Cytogenetics 11q13.3
Domains cyclin_C, CYCLIN, cyclin
Protein Families Druggable Genome, Stem cell - Pluripotency, Stem cell relevant signaling - DSL/Notch pathway, Stem cell relevant signaling - JAK/STAT signaling pathway, Stem cell relevant signaling - Wnt Signaling pathway
Protein Pathways Acute myeloid leukemia, Bladder cancer, Cell cycle, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, Focal adhesion, Glioma, Jak-STAT signaling pathway, Melanoma, Non-small cell lung cancer, p53 signaling pathway, Pancreatic cancer, Pathways in cancer, Prostate cancer, Small cell lung cancer, Thyroid cancer, Viral myocarditis, Wnt signaling pathway
Gene Summary The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance throughout the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with tumor suppressor protein Rb and the expression of this gene is regulated positively by Rb. Mutations, amplification and overexpression of this gene, which alters cell cycle progression, are observed frequently in a variety of human cancers. [provided by RefSeq, Dec 2019]

Citations (2)

Other Versions

Other products for "CCND1"
Frequently bought together (2)
CCND1 mouse monoclonal antibody, clone OTI1G2 (formerly 1G2)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools