Clusterin(CLU) (NM_001831) Human Untagged Clone

CAT#: SC118977

CLU (untagged)-Human clusterin (CLU), transcript variant 1

USD 794.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name Clusterin(CLU) (NM_001831) Human Untagged Clone
Symbol CLU
Synonyms AAG4; APO-J; APOJ; CLI; CLU1; CLU2; KUB1; NA1/NA2; SGP-2; SGP2; SP-40; TRPM-2; TRPM2
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118977 sequence for NM_001831 edited (data generated by NextGen Sequencing)
ATGCAGGTTTGCAGCCAGCCCCAAAGGGGGTGTGTGCGCGAGCAGAGCGCTATAAATACG
GCGCCTCCCAGTGCCCACAACGCGGCGTCGCCAGGAGGAGCGCGCGGGCACAGGGTGCCG
CTGACCGAGGCGTGCAAAGACTCCAGAATTGGAGGCATGATGAAGACTCTGCTGCTGTTT
GTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGAC
AATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTACGTCAATAAGGAAATTCAAAAT
GCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAGCGCAAG
ACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACC
AGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCC
CTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTC
TGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCG
CCCTTCTACTTCTGGATGAATGGTGACCGCATCGACTCCCTGCTGGAGAACGACCGGCAG
CAGACGCACATGCTGGATGTCATGCAGGACCACTTCAGCCGCGCGTCCAGCATCATAGAC
GAGCTCTTCCAGGACAGGTTCTTCACCCGGGAGCCCCAGGATACCTACCACTACCTGCCC
TTCAGCCTGCCCCACCGGAGGCCTCACTTCTTCTTTCCCAAGTCCCGCATCGTCCGCAGC
TTGATGCCCTTCTCTCCGTACGAGCCCCTGAACTTCCACGCCATGTTCCAGCCCTTCCTT
GAGATGATACACGAGGCTCAGCAGGCCATGGACATCCACTTCCATAGCCCGGCCTTCCAG
CACCCGCCAACAGAATTCATACGAGAAGGCGACGATGACCGGACTGTGTGCCGGGAGATC
CGCCACAACTCCACGGGCTGCCTGCGGATGAAGGACCAGTGTGACAAGTGCCGGGAGATC
TTGTCTGTGGACTGTTCCACCAACAACCCCTCCCAGGCTAAGCTGCGGCGGGAGCTCGAC
GAATCCCTCCAGGTCGCTGAGAGGTTGACCAGGAAATACAACGAGCTGCTAAAGTCCTAC
CAGTGGAAGATGCTCAACACCTCCTCCTTGCTGGAGCAGCTGAACGAGCAGTTTAACTGG
GTGTCCCGGCTGGCAAACCTCACGCAAGGCGAAGACCAGTACTATCTGCGGGTCACCACG
GTGGCTTCCCACACTTCTGACTCGGACGTTCCTTCCGGTGTCACTGAGGTGGTCGTGAAG
CTCTTTGACTCTGATCCCATCACTGTGACGGTCCCTGTAGAAGTCTCCAGGAAGAACCCT
AAATTTATGGAGACCGTGGCGGAGAAAGCGCTGCAGGAATACCGCAAAAAGCACCGGGAG
GAGTGA

Clone variation with respect to NM_001831.2
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001831 unedited
AGAATTTTGTAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGCTTTCCGC
GGCATTCTTTGGGCGTGAGTCATGCAGGTTTGCAGCCAGCCCCAAAGGGGGTGTGTGCGC
GAGCAGAGCGCTATAAATACGGCGCCTCCCAGTGCCCACAACGCGGCGTCGCCAGGAGGA
GCGCGCGGGCACAGGGTGCCGCTGACCGAGGCGTGCAAAGACTCCAGAATTGGAGGCATG
ATGAAGACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTG
GGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTAC
GTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAA
AAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAA
GAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTG
TGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGC
ATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCANGCCTGGTTGGCCGCCAGCTTGAG
GAGTTCCTGAACCAGAGCTCGCCCTTCTACTTCTGGATGAATGGTGACCGCATCGACTCC
CTGCTGGAGAACGACCGGCAGCAGACGCACATGCTGGNATGTCATGCAGGACCACTTCAG
CCGCGCGTCCAGCATCATAGACGAGCTCTTCAGNACAGTTNCTTCACCCGGGAGCCCCAG
ATACCTACACTATNNNNNN
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001831 unedited
AGGANACCGGGTCACAGGGCATGCCACCCGGGTATCTGTTCAGGAAAACAGCTATGACCG
CGGCCGCAATCTAGAGTCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTTCCACCCCACAAAACATTTTTATTGAATTATTTGCAGGCA
GGAACAATTTTTTTCTTCCCATGAACACCAAATTCAAGTGTTAAAGTGCAGGATCCAAAC
CGGGGAAAGGCTGGGCGGATTTGGGGCCCCGGAGGCCGGGGCCTGTTTACTTGGTGACCT
GCAAACCCCTCTCGGGGGGGCCCCCCCCCATCTTGGGGGGAGCTGGACTCAAATCCCCCC
GTGGGGGCAAAAACAAAATCCACATCTCACTCCTCCCGGTGCTTTTTGGGGTTTTCCGGC
CGCGCTTTCCCCCCCACGGTCCCCAAAAATTTAGGGTTCTCCCGGGAAACTTCTACGGGG
ACCGTCACAGGGGGGGGTTCAAAATCAAAAAACTTCACAACCCCCCCAGTGACCCCGGAA
GGAACGTCCGAATCAAAAGTGTGGGAACCCACCGTGGTCACCCCAAAAAAAAACGGGTCT
CTCCCCTTGCGGGGAGTTTCCCCCCCCGGGACACCAATTAAACGGGCCGTTTCACCGCCC
CCAAAAGGGGGGAGGGGGTGAACACCCTCCCCCGGGTGGGAAATTTAACCACCCCTTGTT
TTTTCGCGGGCCCCCCCCCCACCACCCGAGGGGAATTCCTCAACCTCCCACACAAACATA
AATCGGGGGGGGGTTGTTTGGGGGAACAACTCACACAAAAATATTTCTCCCGGCAATCGA
AACAAGAGGTTTTCTTTCCAGGAAAAACCCGAGGGGTTGTGGACGAGATCCCCCAAACAA
AAAGAA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001831
ORF Size 1506 bp
Insert Size 1900
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001831.2, NP_001822
RefSeq Size 2859
Locus ID 1191
Cytogenetics 8p21.1
Domains CLa
Protein Families Secreted Protein, Druggable Genome
Gene Summary The protein encoded by this gene is a secreted chaperone that can under some stress conditions also be found in the cell cytosol. It has been suggested to be involved in several basic biological events such as cell death, tumor progression, and neurodegenerative disorders. Alternate splicing results in both coding and non-coding variants.[provided by RefSeq, May 2011]
Transcript Variant: This variant (1) encodes the functional protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations