Alpha B Crystallin (CRYAB) (NM_001885) Human Untagged Clone

CAT#: SC118965

Reviews ()
Write a review

CRYAB (untagged)-Human crystallin, alpha B (CRYAB)



  "NM_001885" in other vectors (6)

Reconstitution Protocol

USD 429.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CRYAB
Synonyms CMD1II; CRYA2; CTPP2; CTRCT16; HEL-S-101; HSPB5; MFM2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC118965 sequence for NM_001885 edited (data generated by NextGen Sequencing)
ATGGACATCGCCATCCACCACCCCTGGATCCGCCGCCCCTTCTTTCCTTTCCACTCCCCC
AGCCGCCTCTTTGACCAGTTCTTCGGAGAGCACCTGTTGGAGTCTGATCTTTTCCCGACG
TCTACTTCCCTGAGTCCCTTCTACCTTCGGCCACCCTCCTTCCTGCGGGCACCCAGCTGG
TTTGACACTGGACTCTCAGAGATGCGCCTGGAGAAGGACAGGTTCTCTGTCAACCTGGAT
GTGAAGCACTTCTCCCCAGAGGAACTCAAAGTTAAGGTGTTGGGAGATGTGATTGAGGTG
CATGGAAAACATGAAGAGCGCCAGGATGAACATGGTTTCATCTCCAGGGAGTTCCACAGG
AAATACCGGATCCCAGCTGATGTAGACCCTCTCACCATTACTTCATCCCTGTCATCTGAT
GGGGTCCTCACTGTGAATGGACCAAGGAAACAGGTCTCTGGCCCTGAGCGCACCATTCCC
ATCACCCGTGAAGAGAAGCCTGCTGTCACCGCAGCCCCCAAGAAATAG

Clone variation with respect to NM_001885.1
>OriGene 5' read for NM_001885 unedited
GTGCACAATTGTATACGACTCCTATAGGCGGCCCGCGAATTCGCACGAGGTTTCTTAGCT
CAGTGAGTACTGGGTATGTGTCACATTGCCAAATCCCGGATCACAAGTCTCCATGAACTG
CTGGTGAGCTAGGATAATAAAACCCCTGACATCACCATTCCAGAAGCTTCACAAGACTGC
ATATATAAGGGGCTGGCTGTAGCTGCAGCTGAAGGAGCTGACCAGCCAGCTGACCCCTCA
CACTCACCTAGCCACCATGGACATCGCCATCCACCACCCCTGGATCCGCCGCCCCTTCTT
TCCTTTCCACTCCCCCAGCCGCCTCTTTGACCAGTTCTTCGGAGAGCACCTGTTGGAGTC
TGATCTTTTCCCGACGTCTACTTCCCTGAGTCCCTTCTACCTTCGGCCACCCTCCTTCCT
GCGGGCACCCAGCTGGTTTGACACTGGACTCTCAGAGATGCGCCTGGAGAAGGACAGGTT
CTCTGTCAACCTGGATGTGAAGCACTTCTCCCCAGAGGAACTCAAAGTTAAGGTGTTGGG
AGATGTGATTGAGGTGCATGGAAAACATGAAGAGCGCCAGGATGAACATGGTTTCATCTC
CAGGGAGTTCCACAGGAAATACCGGATCCCAGCTGATGTAGACCCTCTCACCATTACTTC
ATCCCTGTCATCTGATGGGGTCCTCACTGTGAATGGACCCAAGAAACAGGTCTCTGGCCC
TGAGCGCACCATTCCCATCACCCGTGAAGAGAGCCTGCTGTCACCGCAGCCCCCAAGAAT
AGATGCCCTTCCTCGATNGCCATTTTTAAACCAGAAAGTTCCCCCACAGTGAATGAAGTC
CTGTGACTAATGCTGAAGCTTATTATGCTAAAGGCNGCCCCAATATCAAGCTATAAAAAT
CCATCACAACAAN
>OriGene 3' read for NM_001885 unedited
CGGCACGCAATCTAGGATCGAGTTTTTTTTTTTTTTTTTTCTGTTGCTGAATGATATTTT
ATTAGCTTGATAATTTGGGCCTGCCCTTAGCATTAATAAGCTTCAGCACTAGTCACAAGA
CTTTCATTCACTGGTGGGGAAACTTTCTTGTTTTAAAAAATGCAATTCAAGAAAGGGCAT
CTATTTCTTGGGGGCTGCGGTGACAGCAGGCTTCTCTTCACGGGTGATGGGAATGGTGCG
CTCAGGGCCAGAGACCTGTTTCCTTGGTCCATTCACAGTGAGGACCCCATCAGATGACAG
GGATGAAGTAATGGTGAGAGGGTCTACATCAGCTGGGATCCGGTATTTCCTGTGGAACTC
CCTGGAGATGAAACCATGTTCATCCTGGCGCTCTTCATGTTTTCCATGCACCTCAATCAC
ATCTCCCAACACCTTAACTTTGAGTTCCTCTGGGGAGAAGTGCTTCACATCCAGGTTGAC
AGAGAACCTGTCCTTCTCCAGGCGCATCTCTGAGAGTCCAGTGTCAAACCAGCTGGGTGC
CCGCAGGAAGGAGGGTGGCCGAAGGTAGAAGGGACTCAGGGAAGTAGACGTCGGGAAAAG
ATCAGACTCCAACAGGTGCTCTCCGAAGAACTGGTCAAAGAGGCGGCTGGGGGAGTGGAA
AGGAAAGAAGGGGCGGCGGATCCAGGGGTGGTGGATGGCGATGTCCATGGTGGCTAGGTG
AGTGTGAGGGGTCAGCTGGCTGGTCAGCTCCTTCAGCTGCAGCTACAGCCAGCCCCTTAT
ATATGCAGTCTTGTGAAGCTTCTGGAATGGTGATGTCAGGGGTTTTATTATCCTAGCTCA
CAGCAGTTCATGGAGACTTGTGATCCCNGGANNNTGCATGTGACACATACCAGTACTNAC
TGAGCCTAGAAACCTCTGCCGNAATCGCGCCGNCCTATATGAGTCGATTACAAATCTGAC
GNTACTAAACAGCTTGCTA
Restriction Sites NotI-NotI     
ACCN NM_001885
Insert Size 980 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001885.1, NP_001876.1
RefSeq Size 691 bp
RefSeq ORF 528 bp
Locus ID 1410
UniProt ID P02511
Cytogenetics 11q23.1
Domains HSP20, crystallin
Gene Summary Mammalian lens crystallins are divided into alpha, beta, and gamma families. Alpha crystallins are composed of two gene products: alpha-A and alpha-B, for acidic and basic, respectively. Alpha crystallins can be induced by heat shock and are members of the small heat shock protein (HSP20) family. They act as molecular chaperones although they do not renature proteins and release them in the fashion of a true chaperone; instead they hold them in large soluble aggregates. These heterogeneous aggregates consist of 30-40 subunits; the alpha-A and alpha-B subunits have a 3:1 ratio, respectively. Two additional functions of alpha crystallins are an autokinase activity and participation in the intracellular architecture. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Alpha-A and alpha-B gene products are differentially expressed; alpha-A is preferentially restricted to the lens and alpha-B is expressed widely in many tissues and organs. Elevated expression of alpha-B crystallin occurs in many neurological diseases; a missense mutation cosegregated in a family with a desmin-related myopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2019]

Other Versions

Other products for "CRYAB"
Frequently bought together (4)
CRYAB (Alpha B Crystallin) mouse monoclonal antibody, clone OTI6D11 (formerly 6D11)
    • 100 ul

USD 417.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 473.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

USD 149.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

USD 55.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.