D Amino Acid Oxidase(DAO) (NM_001917) Human Untagged Clone

CAT#: SC118941

DAO (untagged)-Human D-amino-acid oxidase (DAO)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name D Amino Acid Oxidase(DAO) (NM_001917) Human Untagged Clone
Symbol DAO
Synonyms DAAO; DAMOX; OXDA
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118941 sequence for NM_001917 edited (data generated by NextGen Sequencing)
ATGCGTGTGGTGGTGATTGGAGCAGGAGTCATCGGGCTGTCCACCGCCCTCTGCATCCAT
GAGCGCTACCACTCAGTCCTGCAGCCACTGGACATAAAGGTCTACGCGGACCGCTTCACC
CCACTCACCACCACCGACGTGGCTGCCGGCCTCTGGCAGCCCTACCTTTCTGACCCCAAC
AACCCACAGGAGGCGGACTGGAGCCAACAGACCTTTGACTATCTCCTGAGCCATGTCCAT
TCTCCCAACGCTGAAAACCTGGGCCTGTTCCTAATCTCGGGCTACAACCTCTTCCATGAA
GCCATTCCGGACCCTTCCTGGAAGGACACAGTTCTGGGATTTCGGAAGCTGACCCCCAGA
GAGCTGGATATGTTCCCAGATTACGGCTATGGCTGGTTCCACACAAGCCTAATTCTGGAG
GGAAAGAACTATCTACAGTGGCTGACTGAAAGGTTAACTGAGAGGGGAGTGAAGTTCTTC
CAGCGGAAAGTGGAGTCTTTTGAGGAGGTGGCAAGAGAAGGCGCAGACGTGATTGTCAAC
TGCACTGGGGTATGGGCTGGGGCGCTACAACGAGACCCCCTGCTGCAGCCAGGCCGGGGG
CAGATCATGAAGGTGGACGCCCCTTGGATGAAGCACTTCATTCTCACCCATGACCCAGAG
AGAGGCATCTACAATTCCCCGTACATCATCCCAGGGACCCAGACAGTTACTCTTGGAGGC
ATCTTCCAGTTGGGAAACTGGAGTGAACTAAACAATATCCAGGACCACAACACCATTTGG
GAAGGCTGCTGCAGACTGGAGCCCACACTGAAGAATGCAAGAATTATTGGTGAACGAACT
GGCTTCCGGCCAGTACGCCCCCAGATTCGGCTAGAAAGAGAACAGCTTCGCACTGGACCT
TCAAACACAGAGGTCATCCACAACTATGGCCATGGAGGCTACGGGCTCACCATCCACTGG
GGATGTGCCCTGGAGGCAGCCAAGCTCTTTGGGAGAATCCTGGAAGAAAAGAAATTGTCC
AGAATGCCACCATCCCACCTCTGA

Clone variation with respect to NM_001917.4
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001917 unedited
AGGATTTGTATACGACTTCTATAGGGCGGCCGCGAATTCGCACGAGGGAGATCCAGCCTC
TCAAACATCCAGCAGAGAGACCATAGGCTGCTGCAATGCGTGTGGTGGTGATTGGAGCAG
GAGTCATCGGGCTGTCCACCGCCCTCTGCATCCATGAGCGCTACCACTCAGTCCTGCAGC
CACTGGACATAAAGGTCTACGCGGACCGCTTCACCCCACTCACCACCACCGACGTGGCTG
CCGGCCTCTGGCAGCCCTACCTTTCTGACCCCAACAACCCACAGGAGGCGGACTGGAGCC
AACAGACCTTTGACTATCTCCTGAGCCATGTCCATTCTCCCAACGCTGAAAACCTGGGCC
TGTTCCTAATCTCGGGCTACAACCTCTTCCATGAAGCCATTCCGGACCCTTCCTGGAAGG
ACACAGTTCTGGGATTTCGGAAGCTGACCCCCAGAGAGCTGGATATGTTCCCAGATTACG
GCTATGGCTGGTTCCACACAAGCCTAATTCTGGAGGGAAAGAACTATCTACAGTGGCTGA
CTGAAAGGTTAACTGAGAGGGGAGTGAAGTTCTTCCAGCGGAAAGTGGAGTCTTTTGAGG
AGGTGGCAAGAGAAGGCGCAGACGTGATTGTCAACTGCACTGGGGTATGGGCTGGGGCGC
TACAACGAGACCCCCTGCTGCAGCCCAGCCCNGGGGCAGATCATGAAAGTGGACGCCCCT
TGGATGAAGCACTTTATTCTCACCCATGACCCCAGAGAGAAGCATCTACCATTCCCCCGT
ACATCATCCCCAGGACCCAGACAGTTACTCTTGGAGGCATCCTCCAGTTGGGAAACTGGA
GTGAACTAAACATATCCAGGACCACACACCATTTGTGGAAGCTGCTGCAGACTGAAGCCC
AACTGAAGATGCCAGATNTATTGGTGACGAACTGGCTTCCTCCCATCC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_001917 unedited
CGGCCGCAATCTANAGTCGAGTTTTTTTTTTTTTTTTTTGCAGGACTTTTCAGAACCTTT
AATATGTTAGTACAACTTGTAATCAGGTTACTTAGCCTCAATTATCCTCCATTTTCTGTG
GCTCTGGGCAGTTGGCCTCTTTGATTTTCTGAGCTGTCCTTTCTTCTGAAGACTCATGGA
ATGACAGCCTCAGCTGTTCTTTATAATGCCAGACCCAGAGAAGGTAGAGGGATTTCAGTG
ATGAGAGGGGCCCCATGTTGGGCTGAACCCTTCTCCAGGCACTGACTTTGTGGCTTTCTC
TCACCTCATGCTTCTTTGAGGAAAGAAGTGAGGGAGAAGCAATGGCTTATGAAGGAGCAC
ATTGATTCATTGGCTGAGGGGAGAAGGGAGTTCTTGTGGGGGGAGGCAGCAGTCACTGGA
GTCTTCAGAGGTGGGATGGTGGCATTCTGGACAATTTCTTTTCTTCCAGGATTCTCCCAA
AGAGCTTGGCTGCCTCCAGGGCACATCCCCAGTGGATGGTGAGCCCGTAGCCTCCATGGC
CATAGTTGTGGATGACCTCTGTGTTTGAAGGTCCAGTGCGAAGCTGTTCTCTTTCTAGCC
GAATCTGGGGGCGTACTGGCCGGAAGCCAGTTCGTTCACCAATAATTCTTGCATTCTTCA
GTGTGGGCTCCAGTCTGCAGCAGCCTTCCCAAATGGTGTTGTGGTCCTGGATATTGTTTA
GTTCACTCCAGTTTCCCAACTGGAAGATGCCTCCAAGAGTAACTGTCTGGGTCCCTGGGA
TGATGTACGGGGCATTGTAAATGCCTCTCTCTGGCTCATGGGTGAGAATGAAGTGCTTCT
CCCAGGGGCGTCCACCTTCTGATCTGCCCCCGCCTCGCTGANCANGGGGTCTCCGTGTAA
CGCCCCACCCTACCCATGCCAGTGGACATCACTCTGCGCCTCTCTTGCACTCCCAAAAGA
CCCACTTTCGCTGGGAGACTTCCTCCCT
Restriction Sites ECoRI-NOT     
Tag Tag Free
ACCN NM_001917
ORF Size 1044 bp
Insert Size 1590
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001917.3, NP_001908
RefSeq Size 1576
Locus ID 1610
Cytogenetics 12q24.11
Domains DAO
Protein Families Druggable Genome
Protein Pathways Glycine, serine and threonine metabolism, Arginine and proline metabolism, D-Arginine and D-ornithine metabolism, Metabolic pathways
Gene Summary This gene encodes the peroxisomal enzyme D-amino acid oxidase. The enzyme is a flavoprotein which uses flavin adenine dinucleotide (FAD) as its prosthetic group. Its substrates include a wide variety of D-amino acids, but it is inactive on the naturally occurring L-amino acids. Its biological function is not known; it may act as a detoxifying agent which removes D-amino acids that accumulate during aging. In mice, it degrades D-serine, a co-agonist of the NMDA receptor. This gene may play a role in the pathophysiology of schizophrenia. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.