EIF4E (NM_001968) Human Untagged Clone

CAT#: SC118908

EIF4E (untagged)-Human eukaryotic translation initiation factor 4E (EIF4E), transcript variant 1

USD 196


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name EIF4E (NM_001968) Human Untagged Clone
Symbol EIF4E
Synonyms AUTS19; CBP; eIF-4E; EIF4E1; EIF4EL1; EIF4F
Vector pCMV6-XL5
Sequence Data
Fully Sequenced ORF
>OriGene ORF within SC118908 sequence for NM_001968 edited (data generated by NextGen Sequencing)
ATGGCGACTGTCGAACCGGAAACCACCCCTACTCCTAATCCCCCGACTACAGAAGAGGAG
AAAACGGAATCTAATCAGGAGGTTGCTAACCCAGAACACTATATTAAACATCCCCTACAG
AACAGATGGGCACTCTGGTTTTTTAAAAATGATAAAAGCAAAACTTGGCAAGCAAACCTG
CGGCTGATCTCCAAGTTTGATACTGTTGAAGACTTTTGGGCTCTGTACAACCATATCCAG
TTGTCTAGTAATTTAATGCCTGGCTGTGACTACTCACTTTTTAAGGATGGTATTGAGCCT
ATGTGGGAAGATGAGAAAAACAAACGGGGAGGACGATGGCTAATTACATTGAACAAACAG
CAGAGACGAAGTGACCTCGATCGCTTTTGGCTAGAGACACTTCTGTGCCTTATTGGAGAA
TCTTTTGATGACTACAGTGATGATGTATGTGGCGCTGTTGTTAATGTTAGAGCTAAAGGT
GATAAGATAGCAATATGGACTACTGAATGTGAAAACAGAGAAGCTGTTACACATATAGGG
AGGGTATACAAGGAAAGGTTAGGACTTCCTCCAAAGATAGTGATTGGTTATCAGTCCCAC
GCAGACACAGCTACTAAGAGCGGCTCCACCACTAAAAATAGGTTTGTTGTTTAA

Clone variation with respect to NM_001968.3
5' Read Nucleotide Sequence
>OriGene 5' read for NM_001968 unedited
GCAATTGTATACGACTCACTATAGGGCGGCCGCGAAATTCGCACGAGGTCTGGAGCGGTT
GTGCGATCAGATCGATCTAAGATGGCGACTGTCGAACCGGAAACCACCCCTACTCCTAAT
CCCCCGACTACAGAAGAGGAGAAAACGGAATCTAATCAGGAGGTTGCTAACCCAGAACAC
TATATTAAACATCCCCTACAGAACAGATGGGCACTCTGGTTTTTTAAAAATGATAAAAGC
AAAACTTGGCAAGCAAACCTGCGGCTGATCTCCAAGTTTGATACTGTTGAAGACTTTTGG
GCTCTGTACAACCATATCCAGTTGTCTAGTAATTTAATGCCTGGCTGTGACTACTCACTT
TTTAAGGATGGTATTGAGCCTATGTGGGAAGATGAGAAAAACAAACGGGGAGGACGATGG
CTAATTACATTGAACAAACAGCAGAGACGAAGTGACCTCGATCGCTTTTGGCTAGAGACA
CTTCTGTGCCTTATTGGAGAATCTTTTGATGACTACAGTGATGATGTATGTGGCGCTGTT
GTTAATGTTAGAGCTAAAGGTGATAAGATAGCAATATGGACTACTGAATGTGAAAACAGA
GAAGCTGTTACACATATAGGGAGGGTATACAAGGAAAGGTTAGGACTTCCTCCAAAGATA
GTGATTGGTTATCAGTCCCACGCAGACACAGCTACTAAGAGCGGCTCCACCACTAAAAAT
AGGGTTTGTTGTTTAAGAAGACACCTTCTGAGTATTCTCATAGGAGACTGCGTCAAGCAA
TCGAGATTTGGGAGCTGAACCAAAGCCTCTTCAAAAAGCAGAGTGGACTGCATTTAAAAT
TGATTTCCATCTTAATGGTACTCAGATATAAGAGAAGTCTCATTCGCCTTTGNNCTGNAC
TCTGNGTCATTTTTTTTTTTTTTTGGCTANATTNCCCTTNCCATCAAGAATACAGTCCAT
CCCAGATCTAATGTGTTCTGCCACTTGNATA
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_001968
ORF Size 654 bp
Insert Size 2500
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_001968.2, NP_001959
RefSeq Size 2493
RefSeq ORF 654
Locus ID 1977
Cytogenetics 4q23
Domains IF4E
Protein Pathways mTOR signaling pathway, Insulin signaling pathway
Gene Summary The protein encoded by this gene is a component of the eukaryotic translation initiation factor 4F complex, which recognizes the 7-methylguanosine cap structure at the 5' end of messenger RNAs. The encoded protein aids in translation initiation by recruiting ribosomes to the 5'-cap structure. Association of this protein with the 4F complex is the rate-limiting step in translation initiation. This gene acts as a proto-oncogene, and its expression and activation is associated with transformation and tumorigenesis. Several pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015].
Transcript Variant: This variant (1) encodes the shortest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.