GCLM (NM_002061) Human Untagged Clone

CAT#: SC118877

Reviews ()
Write a review

GCLM (untagged)-Human glutamate-cysteine ligase, modifier subunit (GCLM)



  "NM_002061" in other vectors (6)

USD 433.00


Availability*
In Stock

Size
    • 10 ug


Product images

Specifications

Product Data
Product Name GCLM (NM_002061) Human Untagged Clone
Type Human Untagged Clone
Tag Tag Free
Symbol GCLM
Synonyms GLCLR
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Cell Selection None
Sequence Data
>OriGene ORF within SC118877 sequence for NM_002061 edited (data generated by NextGen Sequencing)
ATGGGCACCGACAGCCGCGCGGCCAAGGCGCTCCTGGCGCGGGCCCGCACCCTGCACCTG
CAGACGGGGAACCTGCTGAACTGGGGCCGCCTGCGGAAGAAGTGCCCGTCCACGCACAGC
GAGGAGCTTCATGATTGTATCCAAAAAACCTTGAATGAATGGAGTTCCCAAATCAACCCA
GATTTGGTCAGGGAGTTTCCAGATGTCTTGGAATGCACTGTATCTCATGCAGTAGAAAAG
ATAAATCCTGATGAAAGAGAAGAAATGAAAGTTTCTGCAAAACTGTTCATTGTAGAATCA
AACTCTTCATCATCAACTAGAAGTGCAGTTGACATGGCCTGTTCAGTCCTTGGAGTTGCA
CAGCTGGATTCTGTGATCATTGCTTCACCTCCTATTGAAGATGGAGTTAATCTTTCCTTG
GAGCATTTACAGCCTTACTGGGAGGAATTAGAAAACTTAGTTCAGAGCAAAAAGATTGTT
GCCATAGGTACCTCTGATCTAGACAAAACACAGTTGGAACAGCTGTATCAGTGGGCACAG
GTAAAACCAAATAGTAACCAAGTTAATCTTGCCTCCTGCTGTGTGATGCCACCAGATTTG
ACTGCATTTGCTAAACAATTTGACATACAGCTGTTGACTCACAATGATCCAAAAGAACTG
CTTTCTGAAGCAAGTTTCCAAGAAGCTCTTCAGGAAAGCATTCCTGACATTCAAGCGCAC
GAGTGGGTGCCGCTGTGGCTACTGCGGTATTCGGTCATTGTGAAAAGTAGAGGAATTATC
AAATCAAAAGGCTACATTTTACAAGCTAAAAGAAGGGGTTCTTAA

Clone variation with respect to NM_002061.2
>OriGene 5' read for NM_002061 unedited
GGTTCAAATTTGTATACGACTCATATAGGCGGCCGCCGCGCGGCCGCCTGCCTGCCCGCC
CGCCCGCAGCCCCTTCGCTGCGCGGCCCCTGGGCGGCCGCTGCCATGGGCACCGACAGCC
GCGCGGCCAAGGCGCTCCTGGCGCGGGCCCGCACCCTGCACCTGCAGACGGGGAACCTGC
TGAACTGGGGCCGCCTGCGGAAGAAGTGCCCGTCCACGCACAGCGAGGAGCTTCATGATT
GTATCCAAAAAACCTTGAATGAATGGAGTTCCCAAATCAACCCAGATTTGGTCAGGGAGT
TTCCAGATGTCTTGGAATGCACTGTATCTCATGCAGTAGAAAAGATAAATCCTGATGAAA
GAGAAGAAATGAAAGTTTCTGCAAAACTGTTCATTGTAGAATCAAACTCTTCATCATCAA
CTAGAAGTGCAGTTGACATGGCCTGTTCAGTCCTTGGAGTTGCACAGCTGGATTCTGTGA
TCATTGCTTCACCTCCTATTGAAGATGGAGTTAATCTTTCCTTGGAGCATTTACAGCCTT
ACTGGGAGGAATTAGAAAACTTAGTTCAGAGCAAAAAGATTGTTGCCATAGGTACCTCTG
ATCTAGACAAAACACAGTTGGAACAGCTGTATCAGTGGGCACAGGTAAAACCAAATAGTA
ACCAAGTTAATCTTGCCTCCTGCTGTGTGATGCCACCAGATTTGACTGCATTTGCTAAAC
AATTTGACATACAGCTGTTGACTCACAATGATCCAAAAGAACTGCTTTCTGAAGCAAGTT
CCAAGAAGCTCTTCAGAAAGCATTCCTGACATTCAGCGCACGAANTGGGTGCCGCTGTGG
CTACTGGCGTATTTCGGTCATTGNGGAAAGTNNAGGAATATCAATCAAAGGCTACTTNTA
CAGCTAAGAAAGGGGTCTNAACTGACTAGAGCATACTACTTGGAATNCCTCCATAGANAA
A
>OriGene 3' read for NM_002061 unedited
GGGGGCGGGNTGTCCTTCTCCCCCCCGGCAGATTTGAACCCGGCCGCATCTTATGATCGA
TTTTTTTTTTTTTTTTTTGAAAAGGAGTCTCGCTTTGTCGCCCAGGCTGGAGTGCAGTGA
TGTGATCTCGGCTCACTGTAACCTCCGCCTCCCGGGTTCAAGNGATTNTCCTGCCTTAGC
CTCCCAAGTACCTGATATTACAAGCGAGTGCCACCACGCCCAGCCAATTTTTGTATTTTA
GCCACAGATGCGGCCTCACCATGTTGGCCAGGCTGGTCTCAAACTCCTGACCTCGCGATC
TGCCCACCTCCGCCCCACAAAGTGCTGGTATTACAGGTGCCAGCCACTGCGCCCGCACGA
AATACAACAAATTTTCAAAAGAAAGATTTCACACTATTCAGCGTTACCACACCCCAATTT
ATACACATAACGATACTTCATAGCGCACATCACCAGCTCATACCCTATCTATTCGCCAAT
GTTGACGCCCCGAAAACCAATGCACCAATTAACTTACCTGACTTTTACATTTTTATTCCA
CCTACAAACCTCTCACTCCTACCACTACTCCCCCTACAACACCCCACACCATTATCTTAA
AACTCGTTCCACCTCTATAAAGTACTGACCCGCAATCAAGCAATTCTTTTTCACCCCCCC
CATCTGGCCCTTAAACCCCTCCACAACCACCCCACCACACGGGGGAAAAATAAACCTACC
ACACTTTCACTAAATAAGAATCTAAATTCCTACAATCTAATTGCCCCCTACCTTTTTCTC
CAACGCTCTCTACGAATTCACAAACATCGCAACAAACCATTTTAATCTTCCCTCCACGCC
TCTTATTCACCACTCACCCCAAACCAACACCCCTTCCATGTGCATCAACATATCATTATT
AACCAAATNCCGGATATGCACCGTCCCATAGCACTCTCCTCCCCTTTACCACAACACTCC
CTACAACTACTACCTTTTCATAAGAGCTGTCTAAGTCCTCTCTCCTCCAAANATAATAAC
TCTTCGCCTATCTTCTCTCTCTCCCATCACGCCACCACTATCACACAATCAGATCGCGAC
CTCAAACAATCTNAAAGTGTCCAATCTATATCACACACTCTTCATCAACTCTCTTAACCA
TAATACACATCTNTCGGAATATACATCACACCTATCCCTCN
Restriction Sites NotI-NotI     
ACCN NM_002061
Insert Size 2630 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_002061.2, NP_002052.1
RefSeq Size 3074 bp
RefSeq ORF 825 bp
Locus ID 2730
Cytogenetics 1p22.1
Protein Families Druggable Genome
Protein Pathways Glutathione metabolism, Metabolic pathways
Gene Summary Glutamate-cysteine ligase, also known as gamma-glutamylcysteine synthetase, is the first rate limiting enzyme of glutathione synthesis. The enzyme consists of two subunits, a heavy catalytic subunit and a light regulatory subunit. Gamma glutamylcysteine synthetase deficiency has been implicated in some forms of hemolytic anemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).

Other Versions

Other products for "GCLM"
Frequently bought together (2)
Rabbit polyclonal GCLM Antibody (C-term)
    • 400 ul

USD 465.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools