LTBR (NM_002342) Human Untagged Clone

CAT#: SC118684

LTBR (untagged)-Human lymphotoxin beta receptor (TNFR superfamily, member 3) (LTBR)

USD 196.00


Availability*
In Stock

Size
    • 10 ug

Product images

Specifications

Product Data
Product Name LTBR (NM_002342) Human Untagged Clone
Symbol LTBR
Synonyms CD18; D12S370; LT-BETA-R; TNF-R-III; TNFCR; TNFR-RP; TNFR2-RP; TNFR3; TNFRSF3
Vector pCMV6-XL4
Sequence Data
Fully Sequenced ORF
>OriGene sequence for NM_002342 edited
GAATTCGGCACCAGGGAGCCCTGGAGGCCCGGCCTGGCCGCTCCCGGCCCTGGGGTGCAC
ATCGGCCCTGAGTCCCGTCCCAGGCTCTGGGCTCGGGCAGCCGCCGCCACCGCTGCCCAG
GACGTCGGGCCTCCTGCCTTCCTCCCAGGCCCCCACGTTGCTGGCCGCCTGGCCGAGTGG
CCGCCATGCTCCTGCCTTGGGCCACCTCTGCCCCCGGCCTGGCCTGGGGGCCTCTGGTGC
TGGGCCTCTTCGGGCTCCTGGCAGCATCGCAGCCCCAGGCGGTGCCTCCATATGCGTCGG
AGAACCAGACCTGCAGGGACCAGGAAAAGGAATACTATGAGCCCCAGCACCGCATCTGCT
GCTCCCGCTGCCCGCCAGGCACCTATGTCTCAGCTAAATGTAGCCGCATCCGGGACACAG
TTTGTGCCACATGTGCCGAGAATTCCTACAACGAGCACTGGAACTACCTGACCATCTGCC
AGCTGTGCCGCCCCTGTGACCCAGTGATGGGCCTCGAGGAGATTGCCCCCTGCACAAGCA
AACGGAAGACCCAGTGCCGCTGCCAGCCGGGAATGTTCTGTGCTGCCTGGGCCCTCGAGT
GTACACACTGCGAGCTACTTTCTGACTGCCCGCCTGGCACTGAAGCCGAGCTCAAAGATG
AAGTTGGGAAGGGTAACAACCACTGCGTCCCCTGCAAGGCAGGGCACTTCCAGAATACCT
CCTCCCCCAGCGCCCGCTGCCAGCCCCACACCAGGTGTGAGAACCAAGGTCTGGTGGAGG
CAGCTCCAGGCACTGCCCAGTCCGACACAACCTGCAAAAATCCATTAGAGCCACTGCCCC
CAGAGATGTCAGGAACCATGCTGATGCTGGCCGTTCTGCTGCCACTGGCCTTCTTTCTGC
TCCTTGCCACCGTCTTCTCCTGCATCTGGAAGAGCCACCCTTCTCTCTGCAGGAAACTGG
GATCGCTGCTCAAGAGGCGTCCGCAGGGAGAGGGACCCAATCCTGTAGCTGGAAGCTGGG
AGCCTCCGAAGGCCCATCCATACTTCCCTGACTTGGTACAGCCACTGCTACCCATTTCTG
GAGATGTTTCCCCAGTATCCACTGGGCTCCCCGCAGCCCCAGTTTTGGAGGCAGGGGTGC
CGCAACAGCAGAGTCCTCTGGACCTGACCAGGGAGCCGCAGTTGGAACCCGGGGAGCAGA
GCCAGGTGGCCCACGGTACCAATGGCATTCATGTCACCGGCGGGTCTATGACTATCACTG
GCAACATCTACATCTACAATGGACCAGTACTGGGGGGACCACCGGGTCCTGGAGACCTCC
CAGCTACCCCCGAACCTCCATACCCCATTCCCGAAGAGGGGGACCCTGGCCCTCCCGGGC
TCTCTACACCCCACCAGGAAGATGGCAAGGCTTGGCACCTAGCGGAGACAGAGCACTGTG
GTGCCACACCCTCTAACAGGGGCCCAAGGAACCAATTTATCACCCATGACTGACGGAGTC
TGAGAAAAGGCAGAAGAAGGGGGGCACAAGGGCACCTTCTCCCTTGAGGCTGCCCTGCCC
ACGTGGGATTCACAGGGGCCTGAGTAGGGCCCGGGGAAGCAGAGCCCTAAGGGATTAAGG
CTCAGACACCTCTGAGAGCAGGTGGGCACTGGCTGGGTACGGTGCCCTCCACAGGACTCT
CCCTACTGCCTGAGCAAACCTGAGGCCTCCCGGCAGACCCACCCACCCCCTGGGGCTGCT
CAGCCTCAGGCACGGACAGGGCACATGATACCAACTGCTGCCCACTACGGCACGCCGCAC
CGGAGCACGGCACCGAGGGAGCCGCCACACGGTCACCTGCAAGGACGTCACGGGCCCCTC
TAAAGGATTCGTGGTGCTCATCCCCAAGCTTCAGAGACCCTTTGGGGTTCCACACTTCAC
GTGGACTGAGGTAGACCCTGCATGAAGATGAAATTATAGGGAGGACGCTCCTTCCCTCCC
CTCCTAGAGGAGAGGAAAGGGAGTCATTAACAACTAGGGGGTTGGGTAGGATTCCTAGGT
ATGGGGAAGAGTTTTGGAAGGGGAGGAAAATGGCAAGTGTATTTATATTGTAACCACATG
CAAATAAAAAGAATGGGACCTAGAAAAAAAAAAAAAAAAAACTCGAC
5' Read Nucleotide Sequence
>OriGene 5' read for NM_002342 unedited
NGGTCGCCATTTGTATACGACTCACTATAGGCGGCCGCGAATTCGCACCAGGAGCCCTGG
AGGCCCGGCCTGGCCGCTCCCGGCCCTGGGGTGCACATCGGCCCTGAGTCCCGTCCCAGG
CTCTGGGCTCGGGCAGCCGCCGCCACCGCTGCCCAGGACGTCGGGCCTCCTGCCTTCCTC
CCAGGCCCCCACGTTGCTGGCCGCCTGGCCGAGTGGCCGCCATGCTCCTGCCTTGGGCCA
CCTCTGCCCCCGGCCTGGCCTGGGGGCCTCTGGTGCTGGGCCTCTTCGGGCTCCTGGCAG
CATCGCAGCCCCAGGCGGTGCCTCCATATGCGTCGGAGAACCAGACCTGCAGGGACCAGG
AAAAGGAATACTATGAGCCCCAGCACCGCATCTGCTGCTCCCGCTGCCCGCCAGGCACCT
ATGTCTCAGCTAAATGTAGCCGCATCCGGGACACAGTTTGTGCCACATGTGCCGAGAATT
CCTACAACGAGCACTGGAACTACCTGACCATCTGCCAGCTGTGCCGCCCCTGTGACCCAG
TGATGGGCCTCGAGGAGATTGCCCCCTGCACAAGCAAACGGAAGACCCAGTGCCGCTGCC
AGCCGGGAATGTTCTGTGCTGCCTGGGCCCTCGAGTGTACACACTGCGAGCTACTTTCTG
ACTGCCCGCCTGGCACTGAAGCCGAGCTCAAAGATGAAGTTGGGAAGGGTAACAACCACT
GCGTCCCCTGCAGGCAGGGCACTTNCAGAATACCTNCTNCCCCAGCGCCCGCTGCCAGCC
CCACACCAGGTGTGAGAACCAAGGTCTGGTGGGAGCAGCTNNCAGCACTGGCCAGTCCGA
CACACCTGCAAAATCCATTANAGCACTGCCCCCAGAGAGTCAGGACCATGCTGATGCTGG
NCCGTCTGCTGCACTGGCCCTCTTCTGCTCTTTGCACGTCTCTC
3' Read Nucleotide Sequence
>OriGene 3' read for NM_002342 unedited
CGAGATCTTTTTNNTTTTTTTTTTTNTCTAGGGTCCCATTCTTTTTATTTGCATGTGGTT
ACAATATAAATACACTTGCCATTTTCCTCCCCTTCCAAAACTCTTCCCCATACCTAGGAA
TCCTACCCAACCCCCTAGTTGTTAATGACTCCCTTTCCTCTCCTCTAGGAGGGGAGGGAA
GGAGCGTCCTCCCTATAATTTCATCTTCATGCAGGGTCTACCTCAGTCCACGTGAAGTGT
GGAACCCCAAAGGTCTCTGAAGCTTGGGGATGAGCACCACGAATCCTTTAGAGGGGCCCG
TGACGTCCTTGCAGGTGACCGTGTGGCGGCTCCCTCGGTGCCGTGCTCCGGTGCGGCGTG
CCGTATTGGGCAGCAGTTGGTATCATGTGCCCTGTCCGTGCCTGAGGCTGAGCAGCCCCA
GGGGGTGGGTGGGTCTGCCGGGAGGCCTCAGGTTTGCTCAGGCAGTAGGGAGAGTCCTGT
GGAGGGCACCGTACCCAGCCAGTGCCCACCTGCTCTCAGAGGTGTCTGAGCCTTAATCCC
TTAGGGCTCTGCTTCCCCGGGCCCTACTCAGGCCCCTGTGAATCCCACGTGGGCAGGGCA
GCCTCAAGGGAGAAGGTGCCCTTGTGCCCCCCTTCTTCTGCCTTTTCTCAGACTCCGTCA
GTCATGGGTGATAAATTGGTTCCTTGGGCCCCTGTTAGAGGGTGTGGCACCACAGTGCTC
TGTCTCCGCTAGGTGCCAAGCCTTGCCATCTTCCTGGTGGGGGGTANAAGACCCCGGNAG
GCCAGGGTCCCCCTCTTCGGAATGGGGTATGGGAGTTCGGGGGTACTTGGGGAGGTCTCA
GGACC
Restriction Sites NotI-NotI     
Tag Tag Free
ACCN NM_002342
ORF Size 1308 bp
Insert Size 2250
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reference Data
RefSeq NM_002342.1, NP_002333
RefSeq Size 2136
Locus ID 4055
Cytogenetics 12p13.31
Domains TNFR
Protein Families Transmembrane, Druggable Genome
Protein Pathways Cytokine-cytokine receptor interaction
Gene Summary This gene encodes a member of the tumor necrosis factor receptor superfamily. The major ligands of this receptor include lymphotoxin alpha/beta and tumor necrosis factor ligand superfamily member 14. The encoded protein plays a role in signalling during the development of lymphoid and other organs, lipid metabolism, immune response, and programmed cell death. Activity of this receptor has also been linked to carcinogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.